Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 193 showing 3841 ~ 3860 out of 6,853 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_73722

http://www.addgene.org/73722

Species: Other
Genetic Insert: Snaptag + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755

Proper citation: RRID:Addgene_73722 Copy   


  • RRID:Addgene_73721

http://www.addgene.org/73721

Species: Other
Genetic Insert: Halotag + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755

Proper citation: RRID:Addgene_73721 Copy   


  • RRID:Addgene_73720

    This resource has 1+ mentions.

http://www.addgene.org/73720

Species: Other
Genetic Insert: GFP + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755

Proper citation: RRID:Addgene_73720 Copy   


  • RRID:Addgene_73729

    This resource has 1+ mentions.

http://www.addgene.org/73729

Species: Other
Genetic Insert: C-terminal FLP-on
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755

Proper citation: RRID:Addgene_73729 Copy   


  • RRID:Addgene_73715

    This resource has 1+ mentions.

http://www.addgene.org/73715

Species: Other
Genetic Insert: pU6::sgRNA
Vector Backbone Description: Backbone Marker:Agilent Technologies; Vector Backbone:pBluescript II; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26837755
Comments: 2nd Insert: SapI repair template insertion site; sgRNA insert can be sequenced with oMLS471: 5' - TCCAAGAACTCGTACAAAAATGCTC

Proper citation: RRID:Addgene_73715 Copy   


  • RRID:Addgene_73714

    This resource has 1+ mentions.

http://www.addgene.org/73714

Species: Other
Genetic Insert: pU6::sgRNA
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26837755

Proper citation: RRID:Addgene_73714 Copy   


  • RRID:Addgene_73732

http://www.addgene.org/73732

Species: Other
Genetic Insert: syntron embedded N-terminal FLP-on
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755

Proper citation: RRID:Addgene_73732 Copy   


  • RRID:Addgene_73730

http://www.addgene.org/73730

Species: Other
Genetic Insert: Flexible Linker
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755

Proper citation: RRID:Addgene_73730 Copy   


  • RRID:Addgene_73736

http://www.addgene.org/73736

Species: Other
Genetic Insert: TEV-FLAGtag
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755

Proper citation: RRID:Addgene_73736 Copy   


  • RRID:Addgene_73962

    This resource has 1+ mentions.

http://www.addgene.org/73962

Species: Other
Genetic Insert: gRNA
Vector Backbone Description: Backbone Marker:Merck Millipore; Vector Backbone:pCOLADuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26797514

Proper citation: RRID:Addgene_73962 Copy   


  • RRID:Addgene_73977

http://www.addgene.org/73977

Species: Other
Genetic Insert: shRNA that targets the LacZ gene
Vector Backbone Description: Backbone Size:5622; Vector Backbone:pCAG-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25155555
Comments: The shRNA cassette was obtained via the BLOCK-iTTM PolII miR RNAi Express (Life Technologies).

Proper citation: RRID:Addgene_73977 Copy   


  • RRID:Addgene_74052

http://www.addgene.org/74052

Species: Other
Genetic Insert: AVITEV-GFP
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pMSCV-IRES-GFP (pMIG); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27637333
Comments: The Avi-Tev-Tag is biotinylated by BirA E.coli biotin ligase when coexpressed, and can be cleaved by TEV protease.

Proper citation: RRID:Addgene_74052 Copy   


  • RRID:Addgene_74213

http://www.addgene.org/74213

Species: Other
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pMZ374; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_74213 Copy   


  • RRID:Addgene_74280

    This resource has 1+ mentions.

http://www.addgene.org/74280

Species: Other
Genetic Insert: Renilla luciferase
Vector Backbone Description: Vector Backbone:pRL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23328393

Proper citation: RRID:Addgene_74280 Copy   


  • RRID:Addgene_74409

    This resource has 1+ mentions.

http://www.addgene.org/74409

Species: Other
Genetic Insert: Luciferase
Vector Backbone Description: Vector Backbone:pPY.CAG.CRE.IP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28341702

Proper citation: RRID:Addgene_74409 Copy   


  • RRID:Addgene_74475

http://www.addgene.org/74475

Species: Other
Genetic Insert: mPlum fluorescent protein
Vector Backbone Description: Backbone Marker:Aldevron; Backbone Size:5100; Vector Backbone:gWiz-blank; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Plum is a far red fluorescent protein. Excitation 590 nm Emission 649 nm

Proper citation: RRID:Addgene_74475 Copy   


http://www.addgene.org/74513

Species: Other
Genetic Insert: EGFP-p2A-EGFP-f
Vector Backbone Description: Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26888934

Proper citation: RRID:Addgene_74513 Copy   


  • RRID:Addgene_75021

    This resource has 1+ mentions.

http://www.addgene.org/75021

Species: Other
Genetic Insert: Luciferase
Vector Backbone Description: Backbone Size:6200; Vector Backbone:MIGR1; Vector Types:Retroviral, Luciferase; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_75021 Copy   


  • RRID:Addgene_74961

http://www.addgene.org/74961

Species: Other
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Broad Institute - Genetic Perturbation Platform; Backbone Size:13246; Vector Backbone:pXPR_BRD001; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28178529

Proper citation: RRID:Addgene_74961 Copy   


  • RRID:Addgene_75018

http://www.addgene.org/75018

Species: Other
Genetic Insert: firefly Luciferase
Vector Backbone Description: Backbone Size:5500; Vector Backbone:MIGR1; Vector Types:Retroviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25712988

Proper citation: RRID:Addgene_75018 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X