Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCXLE-hGLIS1 Resource Report Resource Website |
RRID:Addgene_37625 | human GLIS1 | Homo sapiens | Ampicillin | PMID:23193063 | Backbone Size:10184; Vector Backbone:pCXLE-gw; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | T110A, A187G, I221T | 2026-08-15 01:14:16 | 0 | |
|
pBAD Strep His6 TEV LIC cloning vector (8HR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37505 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through | Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 1 | ||||
|
pBAD Strep TEV LIC cloning vector (8R) Resource Report Resource Website |
RRID:Addgene_37506 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8R adds a TEV-cleavable strep tag to the N-terminus of your protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ . | Backbone Size:5693; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | ||||
|
pPD95.75-wVenus Resource Report Resource Website 1+ mentions |
RRID:Addgene_37464 | Ampicillin | PMID:22022276 | Backbone Marker:Andrew Fire (Addgene plasmid # 1494); Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 2 | ||||
|
pNCMV 8E6 Resource Report Resource Website |
RRID:Addgene_37460 | HPV 8E6 | HPV | Ampicillin | PMID:22553330 | The 8E6 template was given to us by Harold Pfister who originally cloned the HPV8 genome. (J. Virology 1986, Pfister H. et al.) | Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | |
|
myc-NLRC5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37509 | NLRC5 | Homo sapiens | Ampicillin | PMID:22490867 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 5 | ||
|
pNCMV 6bE6 Resource Report Resource Website |
RRID:Addgene_37457 | HPV 6bE6 | HPV | Ampicillin | PMID:22553330 | Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | ||
|
pAAV-EF1a-DIO-HB Resource Report Resource Website 1+ mentions |
RRID:Addgene_37452 | Histone, 2A element, rabies B19 glycoprotein | Ampicillin | Please note that there are 2 mutations in Histone, D26G and V119I. These mutations should not affect plasmid function. | Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 4 | |||
|
pHL1561 Resource Report Resource Website |
RRID:Addgene_37571 | CsrA | E. coli | Kanamycin | PMID:23878244 | Backbone Marker:Lim Lab; Vector Backbone:pZ with p15a origin; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:15 | 0 | ||
|
pLentiN 5E6 Resource Report Resource Website |
RRID:Addgene_37449 | HPV 5E6 | HPV | Ampicillin | PMID:22553330 | Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | ||
|
p6897 PHAGE-P CMVT N-HA-hE6AP III wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_37605 | E6AP III | Homo sapiens | Ampicillin | PMID:22645313 | Backbone Size:7800; Vector Backbone:PHAGE-P CMVt N-HA GAW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 2 | ||
|
pLentiN 16E6no* Resource Report Resource Website 1+ mentions |
RRID:Addgene_37445 | HPV 16E6no* | HPV | Ampicillin | PMID:22553330 | Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | V42L | 2026-08-15 01:14:15 | 3 | |
|
pHL1355 Resource Report Resource Website |
RRID:Addgene_37566 | GFP | A. victoria | Ampicillin | PMID:23878244 | Backbone Marker:Lim Lab; Vector Backbone:pZ with ColE origin; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | start codon removed | 2026-08-15 01:14:15 | 0 | |
|
pLentiN 6bE6 Resource Report Resource Website |
RRID:Addgene_37447 | HPV 6bE6 | HPV | Ampicillin | PMID:22553330 | Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | ||
|
pLenti-cytoMetGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_37561 | MET | Homo sapiens | Ampicillin | Backbone Marker:Eric Campeau Addgene Plasmid 17448; Backbone Size:8608; Vector Backbone:pLentiCMV GFP Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | only contains cytoplasmic domain amino acids K956-S1390 | 2026-08-15 01:14:15 | 3 | ||
|
pLenti-MetGFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_37560 | MET | Homo sapiens | Ampicillin | Backbone Marker:Eric Campeau Addgene Plasmid 17448; Backbone Size:8608; Vector Backbone:pLentiCMV GFP Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 22 | |||
|
p6903 PHAGE-B CMV-N-EGFP Myc Resource Report Resource Website |
RRID:Addgene_37608 | Myc | Homo sapiens | Ampicillin | PMID:22645313 | Backbone Size:8344; Vector Backbone:pHAGE-B CMV N-EGFP GAW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:16 | 0 | ||
|
pBSG01 Resource Report Resource Website |
RRID:Addgene_37558 | PreScission protease cleavage site-S tag-TEV site-Z | N/A | Ampicillin | PMID:22431751 | Backbone Size:6515; Vector Backbone:pSY07; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | ||
|
pB-actin 8E6 Resource Report Resource Website |
RRID:Addgene_37438 | HPV 8E6 | HPV | Ampicillin | PMID:22553330 | Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | ||
|
pRS306:Met3p-mCherry-Tub1 Resource Report Resource Website |
RRID:Addgene_37554 | Met3p-mCherry-Tub1 | Saccharomyces cerevisiae | Ampicillin | PMID:21294277 | Backbone Size:4381; Vector Backbone:pRS306; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.