Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Authority:addgene (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

177,820 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pCXLE-hGLIS1
 
Resource Report
Resource Website
RRID:Addgene_37625 human GLIS1 Homo sapiens Ampicillin PMID:23193063 Backbone Size:10184; Vector Backbone:pCXLE-gw; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin T110A, A187G, I221T 2026-08-15 01:14:16 0
pBAD Strep His6 TEV LIC cloning vector (8HR)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_37505 Ampicillin This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 1
pBAD Strep TEV LIC cloning vector (8R)
 
Resource Report
Resource Website
RRID:Addgene_37506 Ampicillin This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8R adds a TEV-cleavable strep tag to the N-terminus of your protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ . Backbone Size:5693; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 0
pPD95.75-wVenus
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_37464 Ampicillin PMID:22022276 Backbone Marker:Andrew Fire (Addgene plasmid # 1494); Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 2
pNCMV 8E6
 
Resource Report
Resource Website
RRID:Addgene_37460 HPV 8E6 HPV Ampicillin PMID:22553330 The 8E6 template was given to us by Harold Pfister who originally cloned the HPV8 genome. (J. Virology 1986, Pfister H. et al.) Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 0
myc-NLRC5
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_37509 NLRC5 Homo sapiens Ampicillin PMID:22490867 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 5
pNCMV 6bE6
 
Resource Report
Resource Website
RRID:Addgene_37457 HPV 6bE6 HPV Ampicillin PMID:22553330 Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 0
pAAV-EF1a-DIO-HB
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_37452 Histone, 2A element, rabies B19 glycoprotein Ampicillin Please note that there are 2 mutations in Histone, D26G and V119I. These mutations should not affect plasmid function. Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 4
pHL1561
 
Resource Report
Resource Website
RRID:Addgene_37571 CsrA E. coli Kanamycin PMID:23878244 Backbone Marker:Lim Lab; Vector Backbone:pZ with p15a origin; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:14:15 0
pLentiN 5E6
 
Resource Report
Resource Website
RRID:Addgene_37449 HPV 5E6 HPV Ampicillin PMID:22553330 Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 0
p6897 PHAGE-P CMVT N-HA-hE6AP III wt
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_37605 E6AP III Homo sapiens Ampicillin PMID:22645313 Backbone Size:7800; Vector Backbone:PHAGE-P CMVt N-HA GAW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 2
pLentiN 16E6no*
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_37445 HPV 16E6no* HPV Ampicillin PMID:22553330 Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin V42L 2026-08-15 01:14:15 3
pHL1355
 
Resource Report
Resource Website
RRID:Addgene_37566 GFP A. victoria Ampicillin PMID:23878244 Backbone Marker:Lim Lab; Vector Backbone:pZ with ColE origin; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin start codon removed 2026-08-15 01:14:15 0
pLentiN 6bE6
 
Resource Report
Resource Website
RRID:Addgene_37447 HPV 6bE6 HPV Ampicillin PMID:22553330 Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 0
pLenti-cytoMetGFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_37561 MET Homo sapiens Ampicillin Backbone Marker:Eric Campeau Addgene Plasmid 17448; Backbone Size:8608; Vector Backbone:pLentiCMV GFP Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin only contains cytoplasmic domain amino acids K956-S1390 2026-08-15 01:14:15 3
pLenti-MetGFP
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_37560 MET Homo sapiens Ampicillin Backbone Marker:Eric Campeau Addgene Plasmid 17448; Backbone Size:8608; Vector Backbone:pLentiCMV GFP Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 22
p6903 PHAGE-B CMV-N-EGFP Myc
 
Resource Report
Resource Website
RRID:Addgene_37608 Myc Homo sapiens Ampicillin PMID:22645313 Backbone Size:8344; Vector Backbone:pHAGE-B CMV N-EGFP GAW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:16 0
pBSG01
 
Resource Report
Resource Website
RRID:Addgene_37558 PreScission protease cleavage site-S tag-TEV site-Z N/A Ampicillin PMID:22431751 Backbone Size:6515; Vector Backbone:pSY07; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 0
pB-actin 8E6
 
Resource Report
Resource Website
RRID:Addgene_37438 HPV 8E6 HPV Ampicillin PMID:22553330 Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 0
pRS306:Met3p-mCherry-Tub1
 
Resource Report
Resource Website
RRID:Addgene_37554 Met3p-mCherry-Tub1 Saccharomyces cerevisiae Ampicillin PMID:21294277 Backbone Size:4381; Vector Backbone:pRS306; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.