Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:other (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

6,853 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pMLS271
 
Resource Report
Resource Website 		RRID:Addgene_73722 Snaptag + Cbr-unc-119 Other Kanamycin PMID:26837755 Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:19:31 0
pMLS254
 
Resource Report
Resource Website 		RRID:Addgene_73721 Halotag + Cbr-unc-119 Other Kanamycin PMID:26837755 Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:19:31 0
pMLS252
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_73720 GFP + Cbr-unc-119 Other Kanamycin PMID:26837755 Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:19:31 2
pMLS279
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_73729 C-terminal FLP-on Other Kanamycin PMID:26837755 Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:19:31 1
pMLS256
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_73715 pU6::sgRNA Other Ampicillin PMID:26837755 2nd Insert: SapI repair template insertion site; sgRNA insert can be sequenced with oMLS471: 5' - TCCAAGAACTCGTACAAAAATGCTC Backbone Marker:Agilent Technologies; Vector Backbone:pBluescript II; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin SapI insertion site 2026-08-15 01:19:31 1
pMLS134
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_73714 pU6::sgRNA Other Ampicillin PMID:26837755 Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin SapI insertion site 2026-08-15 01:19:31 1
pMLS281
 
Resource Report
Resource Website 		RRID:Addgene_73732 syntron embedded N-terminal FLP-on Other Kanamycin PMID:26837755 Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:19:31 0
pMLS287
 
Resource Report
Resource Website 		RRID:Addgene_73730 Flexible Linker Other Kanamycin PMID:26837755 Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:19:31 0
pMLS383
 
Resource Report
Resource Website 		RRID:Addgene_73736 TEV-FLAGtag Other Kanamycin PMID:26837755 Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:19:32 0
pMAZ-SK
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_73962 gRNA Other Kanamycin PMID:26797514 Backbone Marker:Merck Millipore; Vector Backbone:pCOLADuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:19:33 2
CAG-EGFP-LacZshRNA
 
Resource Report
Resource Website 		RRID:Addgene_73977 shRNA that targets the LacZ gene Other Ampicillin PMID:25155555 The shRNA cassette was obtained via the BLOCK-iTTM PolII miR RNAi Express (Life Technologies). Backbone Size:5622; Vector Backbone:pCAG-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:19:33 0
pMSCV-AVITEV-GFP
 
Resource Report
Resource Website 		RRID:Addgene_74052 AVITEV-GFP Other Ampicillin PMID:27637333 The Avi-Tev-Tag is biotinylated by BirA E.coli biotin ligase when coexpressed, and can be cleaved by TEV protease. Backbone Size:5200; Vector Backbone:pMSCV-IRES-GFP (pMIG); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:19:34 0
pMZ376
 
Resource Report
Resource Website 		RRID:Addgene_74213 Cas9 Other Ampicillin Vector Backbone:pMZ374; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin Silent muation of the CspCI site 2026-08-15 01:19:35 0
pRL-ubi63E
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_74280 Renilla luciferase Other Ampicillin PMID:23328393 Vector Backbone:pRL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:19:36 5
Cag.Luc.puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_74409 Luciferase Other Ampicillin PMID:28341702 Vector Backbone:pPY.CAG.CRE.IP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:19:37 3
gWizPlum
 
Resource Report
Resource Website 		RRID:Addgene_74475 mPlum fluorescent protein Other Kanamycin Plum is a far red fluorescent protein. Excitation 590 nm Emission 649 nm Backbone Marker:Aldevron; Backbone Size:5100; Vector Backbone:gWiz-blank; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:19:38 0
pAAV-hSyn1-EGFP-P2A-EGFPf-WPRE-HGHpA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_74513 EGFP-p2A-EGFP-f Other Ampicillin PMID:26888934 Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:19:38 5
MIG-Luciferase-IRES-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_75021 Luciferase Other Ampicillin Backbone Size:6200; Vector Backbone:MIGR1; Vector Types:Retroviral, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:19:42 2
PXPR007 sgGFP-2
 
Resource Report
Resource Website 		RRID:Addgene_74961 GFP Other Ampicillin PMID:28178529 Backbone Marker:Broad Institute - Genetic Perturbation Platform; Backbone Size:13246; Vector Backbone:pXPR_BRD001; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:19:41 0
MI-Luciferase
 
Resource Report
Resource Website 		RRID:Addgene_75018 firefly Luciferase Other Ampicillin PMID:25712988 Backbone Size:5500; Vector Backbone:MIGR1; Vector Types:Retroviral, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:19:42 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch