Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: Snaptag + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73722 Copy
Species: Other
Genetic Insert: Halotag + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73721 Copy
Species: Other
Genetic Insert: GFP + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73720 Copy
Species: Other
Genetic Insert: C-terminal FLP-on
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73729 Copy
Species: Other
Genetic Insert: pU6::sgRNA
Vector Backbone Description: Backbone Marker:Agilent Technologies; Vector Backbone:pBluescript II; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26837755
Comments: 2nd Insert: SapI repair template insertion site; sgRNA insert can be sequenced with oMLS471: 5' - TCCAAGAACTCGTACAAAAATGCTC
Proper citation: RRID:Addgene_73715 Copy
Species: Other
Genetic Insert: pU6::sgRNA
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73714 Copy
Species: Other
Genetic Insert: syntron embedded N-terminal FLP-on
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73732 Copy
Species: Other
Genetic Insert: Flexible Linker
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73730 Copy
Species: Other
Genetic Insert: TEV-FLAGtag
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73736 Copy
Species: Other
Genetic Insert: gRNA
Vector Backbone Description: Backbone Marker:Merck Millipore; Vector Backbone:pCOLADuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26797514
Proper citation: RRID:Addgene_73962 Copy
Species: Other
Genetic Insert: shRNA that targets the LacZ gene
Vector Backbone Description: Backbone Size:5622; Vector Backbone:pCAG-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25155555
Comments: The shRNA cassette was obtained via the BLOCK-iTTM PolII miR RNAi Express (Life Technologies).
Proper citation: RRID:Addgene_73977 Copy
Species: Other
Genetic Insert: AVITEV-GFP
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pMSCV-IRES-GFP (pMIG); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27637333
Comments: The Avi-Tev-Tag is biotinylated by BirA E.coli biotin ligase when coexpressed, and can be cleaved by TEV protease.
Proper citation: RRID:Addgene_74052 Copy
Species: Other
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pMZ374; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_74213 Copy
Species: Other
Genetic Insert: Renilla luciferase
Vector Backbone Description: Vector Backbone:pRL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23328393
Proper citation: RRID:Addgene_74280 Copy
Species: Other
Genetic Insert: Luciferase
Vector Backbone Description: Vector Backbone:pPY.CAG.CRE.IP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28341702
Proper citation: RRID:Addgene_74409 Copy
Species: Other
Genetic Insert: mPlum fluorescent protein
Vector Backbone Description: Backbone Marker:Aldevron; Backbone Size:5100; Vector Backbone:gWiz-blank; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Plum is a far red fluorescent protein.
Excitation 590 nm
Emission 649 nm
Proper citation: RRID:Addgene_74475 Copy
Species: Other
Genetic Insert: EGFP-p2A-EGFP-f
Vector Backbone Description: Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26888934
Proper citation: RRID:Addgene_74513 Copy
Species: Other
Genetic Insert: Luciferase
Vector Backbone Description: Backbone Size:6200; Vector Backbone:MIGR1; Vector Types:Retroviral, Luciferase; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_75021 Copy
Species: Other
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Broad Institute - Genetic Perturbation Platform; Backbone Size:13246; Vector Backbone:pXPR_BRD001; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28178529
Proper citation: RRID:Addgene_74961 Copy
Species: Other
Genetic Insert: firefly Luciferase
Vector Backbone Description: Backbone Size:5500; Vector Backbone:MIGR1; Vector Types:Retroviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25712988
Proper citation: RRID:Addgene_75018 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
