Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,553 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pcDNA3-N-I-N-CAAX
 
Resource Report
Resource Website 		RRID:Addgene_41686 Dronpa145N-IntersectinDH-Dronpa145N-CAAX Homo sapiens Ampicillin PMID:23139335 Backbone Size:5370; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin K145N on Dronpa 2026-08-15 01:14:47 0
pRP_ASC-LmCerulean
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41840 apoptosis-associated speck-like protein containing CARD Homo sapiens Ampicillin PMID:23852599 Backbone Size:7332; Vector Backbone:pRP_LmCerulean; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Stop Codon removed 2026-08-15 01:14:48 6
pSG5-Crkl mut SH3
 
Resource Report
Resource Website 		RRID:Addgene_41705 Crkl Homo sapiens Ampicillin Constructed by Ron de Jong. Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin W160K 2026-08-15 01:14:47 0
pSG5-Crkl mut SH2/SH3
 
Resource Report
Resource Website 		RRID:Addgene_41704 Crkl Homo sapiens Ampicillin Constructed by Ron de Jong. Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R39K and W160K 2026-08-15 01:14:47 0
gRNA_DNMT3b
 
Resource Report
Resource Website 		RRID:Addgene_41823 gRNA_DNMT3b Homo sapiens Kanamycin PMID:23287722 gRNA target sequence GAATTACTCACGCCCCAAGG Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:14:48 0
pCE-hSK
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_41814 SOX2, KLF4 Homo sapiens Ampicillin PMID:23193063 Backbone Size:9364; Vector Backbone:pCE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 50
H9 pMalLP
 
Resource Report
Resource Website 		RRID:Addgene_41811 H9 Super-2 Homo sapiens Ampicillin PMID:22446627 This is an e. coli periplasmic expression vector. H9 has the following mutations compared to wildtype IL-2: L80F, R81F, L85V, I86V, I92F Backbone Size:6700; Vector Backbone:pMalLP; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 0
IL2 F42A pAcGP67a
 
Resource Report
Resource Website 		RRID:Addgene_41807 IL2 Homo sapiens Ampicillin PMID:22446627 Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Phenylalanine 42 to Alanine 2026-08-15 01:14:48 0
IL2 pAcGP67a
 
Resource Report
Resource Website 		RRID:Addgene_41806 IL2 Homo sapiens Ampicillin PMID:22446627 Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 0
HA-EGFP-HaloTag2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41742 Halotag 2 Homo sapiens Ampicillin PMID:21725302 Alternate plasmid name: pCDNA5-KGH2 Backbone Marker:INVITROGEN; Backbone Size:5000; Vector Backbone:PCDNA5; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 5
psiCheck-DNAJA43'UTR
 
Resource Report
Resource Website 		RRID:Addgene_41847 DNAJA4 3'UTR Homo sapiens Ampicillin PMID:23142051 Full-length 3′UTR of DNAJA4 was cloned downstream of a renilla luciferase reporter into the psiCheck2 dual luciferase reporter vector Backbone Marker:Promega; Backbone Size:6200; Vector Backbone:psiCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 0
pBABE puro Brca1 S1423A S1524A HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41968 BRCA1 Homo sapiens Ampicillin PMID:10550055 The BRCA1 insert in this plasmid contains the following common polymorphisms when compared to GenBank reference sequence NP_009225.1: P871L, E1038G, K1182R, and S1613G. These SNPs were likely present in the original cDNA isolate. Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin S1423A, S1524A 2026-08-15 01:14:49 1
psiCheck-ApoE3'UTR
 
Resource Report
Resource Website 		RRID:Addgene_41846 ApoE 3'UTR Homo sapiens Ampicillin PMID:23142051 Full-length 3′UTR of ApoE was cloned downstream of renilla luciferase reporter in the psiCheck2 dual luciferase reporter vector Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 0
pmyc-GFP-TNRC6A-(533-715)
 
Resource Report
Resource Website 		RRID:Addgene_42011 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa533-715 2026-08-15 01:14:49 0
pmyc-GFP-TNRC6A-(935-1709)
 
Resource Report
Resource Website 		RRID:Addgene_42015 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa935-1709 2026-08-15 01:14:49 0
pmyc-GFP-TNRC6A-(457-772)
 
Resource Report
Resource Website 		RRID:Addgene_42007 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa457-772 2026-08-15 01:14:49 0
pmyc-GFP-TNRC6A-(810-924)
 
Resource Report
Resource Website 		RRID:Addgene_42009 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa810-924 2026-08-15 01:14:49 0
pmyc-GFP-TNRC6A-(1-924)
 
Resource Report
Resource Website 		RRID:Addgene_42003 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa1-924 2026-08-15 01:14:49 0
pmyc-GFP-TNRC6A-(925-1709)
 
Resource Report
Resource Website 		RRID:Addgene_42004 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa925-1709 2026-08-15 01:14:49 0
pmyc-GFP-TNRC6A-(1-456)
 
Resource Report
Resource Website 		RRID:Addgene_42005 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa1-456 2026-08-15 01:14:49 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch