Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: CLYBL-CAG-DDdCas9VPH-T2A-GFP
Vector Backbone Description: Backbone Size:6069; Vector Backbone:pUCM-CLYBL-hNIL; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34031600
Proper citation: RRID:Addgene_158091 Copy
Species: Synthetic
Genetic Insert: 6xHis-hA3A(N57Q)-XTEN linker-hSpCas9n(D10A)-UGI-SV40NLS
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32284612
Proper citation: RRID:Addgene_158157 Copy
Species: Synthetic
Genetic Insert: QCP under the Elfa promoter and three BFP tags
Vector Backbone Description: Vector Backbone:Addgene number 75384; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33707432
Comments: Addgene NGS result found different linkers between the BFP's when compared to the backbone #75384. The depositor confirmed they observed strong BFP fluorescence and the different linkers are not a concern.
Proper citation: RRID:Addgene_158206 Copy
Species: Synthetic
Genetic Insert: 10 binding sites of MS2 without the WT sequence from oligo library experiment
Vector Backbone Description: Backbone Size:3800; Vector Backbone:CMV-SV40; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33707432
Proper citation: RRID:Addgene_158204 Copy
Species: Synthetic
Genetic Insert: 10 binding sites with high affinity to PP7 and QB coat proteins based on the machine-learning model
Vector Backbone Description: Backbone Size:3800; Vector Backbone:CMV-SV40; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33707432
Proper citation: RRID:Addgene_158203 Copy
Species: Synthetic
Genetic Insert: 10 binding sites of MS2 from oligo library experiment
Vector Backbone Description: Vector Backbone:CMV-SV40; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33707432
Proper citation: RRID:Addgene_158200 Copy
Species: Synthetic
Genetic Insert: dpcoCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
Vector Backbone Description: Vector Backbone:pYPQ173; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34168320
Comments: Please note: This plasmid is prone to recombination in Agrobacterium. Users are recommended to use plasmid 158414
Proper citation: RRID:Addgene_158408 Copy
Species: Synthetic
Genetic Insert: dpcoCas9-TV(6xTAL-2xVP64)
Vector Backbone Description: Vector Backbone:pYPQ173; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34168320
Proper citation: RRID:Addgene_158409 Copy
Species: Synthetic
Genetic Insert: dzCas9-NG-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
Vector Backbone Description: Vector Backbone:pYPQ173; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34168320
Proper citation: RRID:Addgene_158415 Copy
Species: Synthetic
Genetic Insert: dSpRY-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
Vector Backbone Description: Vector Backbone:pYPQ173; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34168320
Proper citation: RRID:Addgene_158416 Copy
Species: Synthetic
Genetic Insert: 10unit recording array
Vector Backbone Description: Backbone Size:7773; Vector Backbone:pJFRC-MUH; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33833095
Proper citation: RRID:Addgene_158389 Copy
Species: Synthetic
Genetic Insert: S2*HiGlpG
Vector Backbone Description: Backbone Size:4953; Vector Backbone:PGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32795403
Proper citation: RRID:Addgene_158536 Copy
Species: Synthetic
Genetic Insert: PE2
Vector Backbone Description: Vector Backbone:pB-CAG; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_158567 Copy
Species: Synthetic
Genetic Insert: Apixaban-Binding Helical Bundle
Vector Backbone Description: Backbone Marker:genscript; Backbone Size:5641; Vector Backbone:pet11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32883865
Proper citation: RRID:Addgene_158627 Copy
Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pLX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33606977
Comments: For questions regarding use of this plasmid, please contact David Root.
Please visit https://www.biorxiv.org/content/10.1101/2020.05.17.100818v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_158580 Copy
Species: Synthetic
Genetic Insert: natR412 guide
Vector Backbone Description: Backbone Size:11240; Vector Backbone:pML104; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34042294
Comments: This plasmid is derived from Addgene plasmid #67638 pML104 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites.
Guide sequence: GTACCGCACCAGTGTCCCGG
Proper citation: RRID:Addgene_162042 Copy
Species: Synthetic
Genetic Insert: kanR468 guide
Vector Backbone Description: Backbone Size:12367; Vector Backbone:pML107; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34042294
Comments: This plasmid is derived from Addgene plasmid #67639 pML107 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites.
Guide sequence: TCCATGTTGGAATTTAATCG
Proper citation: RRID:Addgene_162041 Copy
Species: Synthetic
Genetic Insert: N-terminal tag, HiBiT-MBP-[Factor Xa cleavage site]
Vector Backbone Description: Vector Backbone:pTwist; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34693026
Proper citation: RRID:Addgene_162296 Copy
Species: Synthetic
Genetic Insert: N-terminal tag, HiBiT-TrxA-[TEV cleavage site]
Vector Backbone Description: Vector Backbone:pTwist; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34693026
Proper citation: RRID:Addgene_162299 Copy
Species: Synthetic
Genetic Insert: N-terminal tag, TrxA-[TEV cleavage site]
Vector Backbone Description: Vector Backbone:pTwist; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34693026
Proper citation: RRID:Addgene_162298 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
