Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: 5" UTR of Mut
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19372376
Proper citation: RRID:Addgene_48165 Copy
Species: Mus musculus
Genetic Insert: 5" UTR of Acsm2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19372376
Proper citation: RRID:Addgene_48158 Copy
Species: P. pyralis
Genetic Insert: luciferase
Vector Backbone Description: Backbone Marker:Courtney Boehlke; Backbone Size:7000; Vector Backbone:pLew90β-T7-GW-Neo; Vector Types:Luciferase, T. cruzi expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20644616
Proper citation: RRID:Addgene_48157 Copy
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705
Proper citation: RRID:Addgene_48149 Copy
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705
Proper citation: RRID:Addgene_48145 Copy
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705
Proper citation: RRID:Addgene_48146 Copy
Genetic Insert: rna polymerase SP6
Vector Backbone Description: Backbone Marker:Gamer et al., 2009; Vector Backbone:pMGBm19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705
Comments: Please note that the V313A mutation in RNAP was present in the original sample and functions as described in the publication.
Proper citation: RRID:Addgene_48143 Copy
Genetic Insert: rna polymerase K1E
Vector Backbone Description: Backbone Marker:Gamer et al., 2009; Vector Backbone:pMGBm19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705
Proper citation: RRID:Addgene_48144 Copy
Species: Synthetic
Genetic Insert: hSpCas9
Vector Backbone Description: Vector Backbone:PX458; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24157548
Comments: For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/.
Proper citation: RRID:Addgene_48138 Copy
Genetic Insert: gfp
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705
Proper citation: RRID:Addgene_48131 Copy
Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:4974; Vector Backbone:pGEX-5x3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848
Proper citation: RRID:Addgene_48090 Copy
Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:6706; Vector Backbone:pTXB1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848
Proper citation: RRID:Addgene_48092 Copy
Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX-Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848
Proper citation: RRID:Addgene_48086 Copy
Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX-Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848
Proper citation: RRID:Addgene_48084 Copy
Genetic Insert: signal peptide of Pac
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20435764
Proper citation: RRID:Addgene_48123 Copy
Genetic Insert: codon optimized signal peptide of YngK
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20435764
Proper citation: RRID:Addgene_48121 Copy
Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:4974; Vector Backbone:pGEX-5x3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848
Proper citation: RRID:Addgene_48089 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT
For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_48238 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Proper citation: RRID:Addgene_48233 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR4; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_48228 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.