Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 195 showing 3881 ~ 3900 out of 30,421 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_158091

    This resource has 1+ mentions.

http://www.addgene.org/158091

Species: Synthetic
Genetic Insert: CLYBL-CAG-DDdCas9VPH-T2A-GFP
Vector Backbone Description: Backbone Size:6069; Vector Backbone:pUCM-CLYBL-hNIL; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34031600

Proper citation: RRID:Addgene_158091 Copy   


  • RRID:Addgene_158157

http://www.addgene.org/158157

Species: Synthetic
Genetic Insert: 6xHis-hA3A(N57Q)-XTEN linker-hSpCas9n(D10A)-UGI-SV40NLS
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32284612

Proper citation: RRID:Addgene_158157 Copy   


  • RRID:Addgene_158206

http://www.addgene.org/158206

Species: Synthetic
Genetic Insert: QCP under the Elfa promoter and three BFP tags
Vector Backbone Description: Vector Backbone:Addgene number 75384; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33707432
Comments: Addgene NGS result found different linkers between the BFP's when compared to the backbone #75384. The depositor confirmed they observed strong BFP fluorescence and the different linkers are not a concern.

Proper citation: RRID:Addgene_158206 Copy   


http://www.addgene.org/158204

Species: Synthetic
Genetic Insert: 10 binding sites of MS2 without the WT sequence from oligo library experiment
Vector Backbone Description: Backbone Size:3800; Vector Backbone:CMV-SV40; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33707432

Proper citation: RRID:Addgene_158204 Copy   


http://www.addgene.org/158203

Species: Synthetic
Genetic Insert: 10 binding sites with high affinity to PP7 and QB coat proteins based on the machine-learning model
Vector Backbone Description: Backbone Size:3800; Vector Backbone:CMV-SV40; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33707432

Proper citation: RRID:Addgene_158203 Copy   


http://www.addgene.org/158200

Species: Synthetic
Genetic Insert: 10 binding sites of MS2 from oligo library experiment
Vector Backbone Description: Vector Backbone:CMV-SV40; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33707432

Proper citation: RRID:Addgene_158200 Copy   


  • RRID:Addgene_158408

    This resource has 1+ mentions.

http://www.addgene.org/158408

Species: Synthetic
Genetic Insert: dpcoCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
Vector Backbone Description: Vector Backbone:pYPQ173; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34168320
Comments: Please note: This plasmid is prone to recombination in Agrobacterium. Users are recommended to use plasmid 158414

Proper citation: RRID:Addgene_158408 Copy   


  • RRID:Addgene_158409

http://www.addgene.org/158409

Species: Synthetic
Genetic Insert: dpcoCas9-TV(6xTAL-2xVP64)
Vector Backbone Description: Vector Backbone:pYPQ173; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34168320

Proper citation: RRID:Addgene_158409 Copy   


http://www.addgene.org/158415

Species: Synthetic
Genetic Insert: dzCas9-NG-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
Vector Backbone Description: Vector Backbone:pYPQ173; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34168320

Proper citation: RRID:Addgene_158415 Copy   


  • RRID:Addgene_158416

http://www.addgene.org/158416

Species: Synthetic
Genetic Insert: dSpRY-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
Vector Backbone Description: Vector Backbone:pYPQ173; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34168320

Proper citation: RRID:Addgene_158416 Copy   


  • RRID:Addgene_158389

http://www.addgene.org/158389

Species: Synthetic
Genetic Insert: 10unit recording array
Vector Backbone Description: Backbone Size:7773; Vector Backbone:pJFRC-MUH; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33833095

Proper citation: RRID:Addgene_158389 Copy   


  • RRID:Addgene_158536

http://www.addgene.org/158536

Species: Synthetic
Genetic Insert: S2*HiGlpG
Vector Backbone Description: Backbone Size:4953; Vector Backbone:PGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32795403

Proper citation: RRID:Addgene_158536 Copy   


  • RRID:Addgene_158567

http://www.addgene.org/158567

Species: Synthetic
Genetic Insert: PE2
Vector Backbone Description: Vector Backbone:pB-CAG; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_158567 Copy   


  • RRID:Addgene_158627

http://www.addgene.org/158627

Species: Synthetic
Genetic Insert: Apixaban-Binding Helical Bundle
Vector Backbone Description: Backbone Marker:genscript; Backbone Size:5641; Vector Backbone:pet11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32883865

Proper citation: RRID:Addgene_158627 Copy   


  • RRID:Addgene_158580

http://www.addgene.org/158580

Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pLX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33606977
Comments: For questions regarding use of this plasmid, please contact David Root. Please visit https://www.biorxiv.org/content/10.1101/2020.05.17.100818v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_158580 Copy   


  • RRID:Addgene_162042

    This resource has 1+ mentions.

http://www.addgene.org/162042

Species: Synthetic
Genetic Insert: natR412 guide
Vector Backbone Description: Backbone Size:11240; Vector Backbone:pML104; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34042294
Comments: This plasmid is derived from Addgene plasmid #67638 pML104 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites. Guide sequence: GTACCGCACCAGTGTCCCGG

Proper citation: RRID:Addgene_162042 Copy   


  • RRID:Addgene_162041

    This resource has 1+ mentions.

http://www.addgene.org/162041

Species: Synthetic
Genetic Insert: kanR468 guide
Vector Backbone Description: Backbone Size:12367; Vector Backbone:pML107; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34042294
Comments: This plasmid is derived from Addgene plasmid #67639 pML107 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites. Guide sequence: TCCATGTTGGAATTTAATCG

Proper citation: RRID:Addgene_162041 Copy   


  • RRID:Addgene_162296

http://www.addgene.org/162296

Species: Synthetic
Genetic Insert: N-terminal tag, HiBiT-MBP-[Factor Xa cleavage site]
Vector Backbone Description: Vector Backbone:pTwist; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34693026

Proper citation: RRID:Addgene_162296 Copy   


  • RRID:Addgene_162299

http://www.addgene.org/162299

Species: Synthetic
Genetic Insert: N-terminal tag, HiBiT-TrxA-[TEV cleavage site]
Vector Backbone Description: Vector Backbone:pTwist; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34693026

Proper citation: RRID:Addgene_162299 Copy   


  • RRID:Addgene_162298

http://www.addgene.org/162298

Species: Synthetic
Genetic Insert: N-terminal tag, TrxA-[TEV cleavage site]
Vector Backbone Description: Vector Backbone:pTwist; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34693026

Proper citation: RRID:Addgene_162298 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X