Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 196 showing 3901 ~ 3920 out of 4,486 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_1307

http://www.addgene.org/1307

Species: Saccharomyces cerevisiae
Genetic Insert: Hsp104 Y819W
Vector Backbone Description: Backbone Size:2375; Vector Backbone:pJC45; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11983167

Proper citation: RRID:Addgene_1307 Copy   


  • RRID:Addgene_1309

http://www.addgene.org/1309

Species: Saccharomyces cerevisiae
Genetic Insert: Hsp104 F130W
Vector Backbone Description: Backbone Size:5586; Vector Backbone:pGAL; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11983167

Proper citation: RRID:Addgene_1309 Copy   


http://www.addgene.org/130986

Species: Saccharomyces cerevisiae
Genetic Insert: FlpO-2A-Cre
Vector Backbone Description: Backbone Marker:ThermoFisher; Vector Backbone:pOG44; Vector Types:Mammalian Expression, Cre/Lox, Unspecified, episomal expression vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31539496
Comments: Self Excising- FlpO and Cre are surrounded by F5 FRT sites but the FlpO contains an intron to prevent bacterial self-recombination during DNA production

Proper citation: RRID:Addgene_130986 Copy   


  • RRID:Addgene_131165

http://www.addgene.org/131165

Species: Saccharomyces cerevisiae
Genetic Insert: ScExo84
Vector Backbone Description: Backbone Marker:Sikorski and Hieter, 1991; Vector Backbone:pRS303; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21938623

Proper citation: RRID:Addgene_131165 Copy   


  • RRID:Addgene_131162

http://www.addgene.org/131162

Species: Saccharomyces cerevisiae
Genetic Insert: 6his-Cdc12 + Cdc11
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET-Duet; Vector Types:Bacterial Expression, bicistronic; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23889817

Proper citation: RRID:Addgene_131162 Copy   


  • RRID:Addgene_131160

http://www.addgene.org/131160

Species: Saccharomyces cerevisiae
Genetic Insert: Cdc3 + Cdc10
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pACYC-Duet1; Vector Types:Bacterial Expression, bicistronic; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:23889817
Comments: combine with pET-Cdc12-Cdc11 for expression of septin rods

Proper citation: RRID:Addgene_131160 Copy   


  • RRID:Addgene_1313

http://www.addgene.org/1313

Species: Saccharomyces cerevisiae
Genetic Insert: Hsp104 L553W
Vector Backbone Description: Backbone Size:5586; Vector Backbone:pGAL; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11983167

Proper citation: RRID:Addgene_1313 Copy   


  • RRID:Addgene_13787

    This resource has 10+ mentions.

http://www.addgene.org/13787

Species: Saccharomyces cerevisiae
Genetic Insert: Flpe
Vector Backbone Description: Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17209010
Comments: Kozak consensus sequence was added before the start ATG. Internal EcoRI site was destroyed by introducing a silent mutation. Myc-tag was added at the C-terminus of Flpe.

Proper citation: RRID:Addgene_13787 Copy   


  • RRID:Addgene_13788

    This resource has 1+ mentions.

http://www.addgene.org/13788

Species: Saccharomyces cerevisiae
Genetic Insert: Flpe-GFP fusion protein
Vector Backbone Description: Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17209010
Comments: Kozak consensus sequence was added before the start ATG. Internal EcoRI site was destroyed by introducing a silent mutation.

Proper citation: RRID:Addgene_13788 Copy   


  • RRID:Addgene_1379

http://www.addgene.org/1379

Species: Saccharomyces cerevisiae
Genetic Insert: NPL3
Vector Backbone Description: Backbone Size:6018; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9499403
Comments: 3.5kb ScaI fragment ligated into SmaI digested vector (CEN plasmid). See author's map.

Proper citation: RRID:Addgene_1379 Copy   


  • RRID:Addgene_138202

    This resource has 1+ mentions.

http://www.addgene.org/138202

Species: Saccharomyces cerevisiae
Genetic Insert: Cerulean-FHA1-NES
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5472; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21438554

Proper citation: RRID:Addgene_138202 Copy   


http://www.addgene.org/138210

Species: Saccharomyces cerevisiae
Genetic Insert: RLuc8C-FHA1-NES
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5472; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21438554

Proper citation: RRID:Addgene_138210 Copy   


http://www.addgene.org/138374

Species: Saccharomyces cerevisiae
Genetic Insert: lox-mCherry-lox-Booster-PKA
Vector Backbone Description: Backbone Size:6500; Vector Backbone:pT2ADW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32101394
Comments: Depositor found that the linker region of the Booster-PKA insert may be 42 bp longer than shown in their reference sequence, but that the plasmid functions as reported in the associated publication. Sequences are based on next-generation sequencing (NGS) results where indicated (Addgene NGS Result), or assembled from reference sequences and/or Sanger results (Addgene Assembled Sequence). Sequence provided by depositing laboratory may be theoretical/predicted or based on Sanger/NGS sequencing results. Discrepancies between sequencing results obtained by Addgene and the original sequence provided by the depositor may be present.

Proper citation: RRID:Addgene_138374 Copy   


  • RRID:Addgene_138376

http://www.addgene.org/138376

Species: Saccharomyces cerevisiae
Genetic Insert: Booster-JNK
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32101394
Comments: Sequences are based on next-generation sequencing (NGS) results where indicated (Addgene NGS Result), or assembled from reference sequences and/or Sanger results (Addgene Assembled Sequence). Sequence provided by depositing laboratory may be theoretical/predicted or based on Sanger/NGS sequencing results. Discrepancies between sequencing results obtained by Addgene and the original sequence provided by the depositor may be present.

Proper citation: RRID:Addgene_138376 Copy   


  • RRID:Addgene_138621

http://www.addgene.org/138621

Species: Saccharomyces cerevisiae
Genetic Insert: GAL4
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_138621 Copy   


  • RRID:Addgene_138658

    This resource has 1+ mentions.

http://www.addgene.org/138658

Species: Saccharomyces cerevisiae
Genetic Insert: 4xCDRE-CYC1(PM)-yEGFP3-PEST
Vector Backbone Description: Vector Backbone:pAMS366; Vector Types:yeast reporter plasmid; Bacterial Resistance:Ampicillin
Comments: 1x CDRE (calcineurin-dependent response element) = caagcgcacagccaccgactggtg For construction of pAMS366-4xCDRE-GFP-PEST, we used yEGFP3-PEST from Mateus & Avery 2000 (original yEGFP3 from Cormack et al. 1997), sequencing showed a 216T>G silent mutation.

Proper citation: RRID:Addgene_138658 Copy   


  • RRID:Addgene_138657

http://www.addgene.org/138657

Species: Saccharomyces cerevisiae
Genetic Insert: 4xCDRE-CYC1(PM)-yeGFP
Vector Backbone Description: Vector Backbone:pAMS366; Vector Types:yeast reporter plasmid; Bacterial Resistance:Ampicillin
Comments: 1x CDRE (calcineurin-dependent response element) = caagcgcacagccaccgactggtg For construction of pAMS366-4xCDRE-GFP, we used yeGFP from pYM25 (Janke et al. 2004, sequence available from euroscarf), sequencing showed a 644C>G (Thr>Arg) mutation."

Proper citation: RRID:Addgene_138657 Copy   


  • RRID:Addgene_138711

http://www.addgene.org/138711

Species: Saccharomyces cerevisiae
Genetic Insert: ura3 gene
Vector Backbone Description: Backbone Marker:Sigma-Aldrich; Backbone Size:7675; Vector Backbone:pACD4K-C; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31419111

Proper citation: RRID:Addgene_138711 Copy   


  • RRID:Addgene_138618

http://www.addgene.org/138618

Species: Saccharomyces cerevisiae
Genetic Insert: GCR1
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_138618 Copy   


  • RRID:Addgene_135086

http://www.addgene.org/135086

Species: Saccharomyces cerevisiae
Genetic Insert: MalE-6xHis-Ulp1
Vector Backbone Description: Vector Backbone:pTST101 ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19127343

Proper citation: RRID:Addgene_135086 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X