Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Drosophila melanogaster
Genetic Insert: porcupine
Vector Backbone Description: Vector Backbone:pNB40; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8985181
Comments: Perrimon Lab plasmid #124
Proper citation: RRID:Addgene_37377 Copy
Species: Drosophila melanogaster
Genetic Insert: PolIII-Renilla control reporter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3320; Vector Backbone:pRL-null; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16311596
Comments: Perrimon Lab plasmid #414
The PolIII–Renilla luciferase control construct was generated by PCR amplification of a fragment (base pairs 43,224–43,389 of scaffold AE003823) of the promoter of the D. melanogaster RNA PolIII 128 subunit (RpIII128) with a 5' BglII and a 3' SpeI site and ligation of this fragment into the BglII and SpeI sites of pRL-null.
Proper citation: RRID:Addgene_37380 Copy
Genetic Insert: Cre Shine
Vector Backbone Description: Backbone Marker:Invitrogene; Backbone Size:5060; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_37404 Copy
Species: Drosophila melanogaster
Genetic Insert: tout-velu
Vector Backbone Description: Vector Backbone:pNB40; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9665133
Comments: Perrimon Lab plasmid #179
Proper citation: RRID:Addgene_37401 Copy
Species: Homo sapiens
Genetic Insert: EEF1D
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21936567
Proper citation: RRID:Addgene_37364 Copy
Species: Homo sapiens
Genetic Insert: npc1l1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5000; Vector Backbone:pFASTBAC; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21525977
Comments: There is a TEV cleavage site downstream of His tag.
Proper citation: RRID:Addgene_37366 Copy
Species: Homo sapiens
Genetic Insert: CK2beta 6KR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5542; Vector Backbone:pRC/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17681943
Proper citation: RRID:Addgene_37361 Copy
Species: Homo sapiens
Genetic Insert: CK2α V66A/I174A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5542; Vector Backbone:pRC/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18258654
Comments: there is a 3bp deletion (AGG) in the MCS 131.
Proper citation: RRID:Addgene_37362 Copy
Species: Synthetic
Genetic Insert: NLS-mCherry
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21397594
Proper citation: RRID:Addgene_37354 Copy
Species: Synthetic
Genetic Insert: membrane TdTomato
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21397594
Comments: *palmitoylation sequence: 5'-atgctgtgctgtatgagaagaaccaaacaggttgaaaagaatgatgaggaccaaaagatc-3'
Proper citation: RRID:Addgene_37351 Copy
Vector Backbone Description: Backbone Size:6053; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8O adds a TEV-cleavable His6-mOCR tag to the N-terminus of your protein. mOCR can enhance the solubility of your protein of interest.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_37504 Copy
Species: Homo sapiens
Genetic Insert: human GLIS1
Vector Backbone Description: Backbone Size:10184; Vector Backbone:pCXLE-gw; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23193063
Proper citation: RRID:Addgene_37625 Copy
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through
Proper citation: RRID:Addgene_37505 Copy
Vector Backbone Description: Backbone Size:5693; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8R adds a TEV-cleavable strep tag to the N-terminus of your protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ .
Proper citation: RRID:Addgene_37506 Copy
Vector Backbone Description: Backbone Marker:Andrew Fire (Addgene plasmid # 1494); Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22022276
Proper citation: RRID:Addgene_37464 Copy
Species: HPV
Genetic Insert: HPV 8E6
Vector Backbone Description: Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Comments: The 8E6 template was given to us by Harold Pfister who originally cloned the HPV8 genome. (J. Virology 1986, Pfister H. et al.)
Proper citation: RRID:Addgene_37460 Copy
Species: Homo sapiens
Genetic Insert: NLRC5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22490867
Proper citation: RRID:Addgene_37509 Copy
Species: HPV
Genetic Insert: HPV 6bE6
Vector Backbone Description: Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Proper citation: RRID:Addgene_37457 Copy
Genetic Insert: Histone, 2A element, rabies B19 glycoprotein
Vector Backbone Description: Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: Please note that there are 2 mutations in Histone, D26G and V119I. These mutations should not affect plasmid function.
Proper citation: RRID:Addgene_37452 Copy
Species: HPV
Genetic Insert: HPV 5E6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Proper citation: RRID:Addgene_37449 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
