Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
porcupine Resource Report Resource Website |
RRID:Addgene_37377 | porcupine | Drosophila melanogaster | Ampicillin | PMID:8985181 | Perrimon Lab plasmid #124 | Vector Backbone:pNB40; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | |
|
Renilla luciferase-Pol III Resource Report Resource Website 1+ mentions |
RRID:Addgene_37380 | PolIII-Renilla control reporter | Drosophila melanogaster | Ampicillin | PMID:16311596 | Perrimon Lab plasmid #414 The PolIII–Renilla luciferase control construct was generated by PCR amplification of a fragment (base pairs 43,224–43,389 of scaffold AE003823) of the promoter of the D. melanogaster RNA PolIII 128 subunit (RpIII128) with a 5' BglII and a 3' SpeI site and ligation of this fragment into the BglII and SpeI sites of pRL-null. | Backbone Marker:Promega; Backbone Size:3320; Vector Backbone:pRL-null; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 6 | |
|
Cre Shine Resource Report Resource Website 1+ mentions |
RRID:Addgene_37404 | Cre Shine | Ampicillin | Backbone Marker:Invitrogene; Backbone Size:5060; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 4 | ||||
|
tout velou (ttv) Resource Report Resource Website |
RRID:Addgene_37401 | tout-velu | Drosophila melanogaster | Ampicillin | PMID:9665133 | Perrimon Lab plasmid #179 | Vector Backbone:pNB40; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | |
|
pFLAG-EEF1D (pcDNA 3.1+) LG3-1 Resource Report Resource Website |
RRID:Addgene_37364 | EEF1D | Homo sapiens | Ampicillin | PMID:21936567 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | ||
|
pfast NPC1L1(NTD) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37366 | npc1l1 | Homo sapiens | Ampicillin | PMID:21525977 | There is a TEV cleavage site downstream of His tag. | Backbone Marker:invitrogen; Backbone Size:5000; Vector Backbone:pFASTBAC; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | aa22-284only | 2026-08-15 01:14:14 | 1 |
|
Myc-CK2beta 6KR (pAB1016) Resource Report Resource Website |
RRID:Addgene_37361 | CK2beta 6KR | Homo sapiens | Ampicillin | PMID:17681943 | Backbone Marker:Invitrogen; Backbone Size:5542; Vector Backbone:pRC/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | K33R, K139R, K177R, K191R, K208R, K212R | 2026-08-15 01:14:14 | 0 | |
|
CK2alpha V66A/I174A-HA (pJD23) Resource Report Resource Website |
RRID:Addgene_37362 | CK2α V66A/I174A | Homo sapiens | Ampicillin | PMID:18258654 | there is a 3bp deletion (AGG) in the MCS 131. | Backbone Marker:Invitrogen; Backbone Size:5542; Vector Backbone:pRC/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | V66A, I174A | 2026-08-15 01:14:14 | 0 |
|
pQC NLS mCherry IX Resource Report Resource Website 1+ mentions |
RRID:Addgene_37354 | NLS-mCherry | Synthetic | Ampicillin | PMID:21397594 | Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 5 | ||
|
pQC membrane TdTomato IX Resource Report Resource Website 1+ mentions |
RRID:Addgene_37351 | membrane TdTomato | Synthetic | Ampicillin | PMID:21397594 | *palmitoylation sequence: 5'-atgctgtgctgtatgagaagaaccaaacaggttgaaaagaatgatgaggaccaaaagatc-3' | Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 7 | |
|
pBad His6 mOCR TEV LIC cloning vector (8O) Resource Report Resource Website |
RRID:Addgene_37504 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8O adds a TEV-cleavable His6-mOCR tag to the N-terminus of your protein. mOCR can enhance the solubility of your protein of interest. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6053; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | ||||
|
pCXLE-hGLIS1 Resource Report Resource Website |
RRID:Addgene_37625 | human GLIS1 | Homo sapiens | Ampicillin | PMID:23193063 | Backbone Size:10184; Vector Backbone:pCXLE-gw; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | T110A, A187G, I221T | 2026-08-15 01:14:16 | 0 | |
|
pBAD Strep His6 TEV LIC cloning vector (8HR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37505 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through | Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 1 | ||||
|
pBAD Strep TEV LIC cloning vector (8R) Resource Report Resource Website |
RRID:Addgene_37506 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8R adds a TEV-cleavable strep tag to the N-terminus of your protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ . | Backbone Size:5693; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | ||||
|
pPD95.75-wVenus Resource Report Resource Website 1+ mentions |
RRID:Addgene_37464 | Ampicillin | PMID:22022276 | Backbone Marker:Andrew Fire (Addgene plasmid # 1494); Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 2 | ||||
|
pNCMV 8E6 Resource Report Resource Website |
RRID:Addgene_37460 | HPV 8E6 | HPV | Ampicillin | PMID:22553330 | The 8E6 template was given to us by Harold Pfister who originally cloned the HPV8 genome. (J. Virology 1986, Pfister H. et al.) | Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | |
|
myc-NLRC5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37509 | NLRC5 | Homo sapiens | Ampicillin | PMID:22490867 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 5 | ||
|
pNCMV 6bE6 Resource Report Resource Website |
RRID:Addgene_37457 | HPV 6bE6 | HPV | Ampicillin | PMID:22553330 | Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | ||
|
pAAV-EF1a-DIO-HB Resource Report Resource Website 1+ mentions |
RRID:Addgene_37452 | Histone, 2A element, rabies B19 glycoprotein | Ampicillin | Please note that there are 2 mutations in Histone, D26G and V119I. These mutations should not affect plasmid function. | Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 4 | |||
|
pLentiN 5E6 Resource Report Resource Website |
RRID:Addgene_37449 | HPV 5E6 | HPV | Ampicillin | PMID:22553330 | Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
