Plasmids   Select Another Resource Report Type

http://www.addgene.org/48310

Vector Backbone Description: Backbone Size:3430; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-Mocr tag on the N-terminus and Amp resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The Series-14 plasmids were designed to overcome the unpredictable expression patterns of genes from a polycistronic message. As mentioned in the Series-2 and Series-9 polycistronic sections, often genes that express well from a single gene mRNA do not express at the same level when placed in a polycistronic message next to other genes. This effect is likely due to mRNA structure interfering with access to the ribosome binding site. When we first made our polypromoter plasmids we found that we could clone multiple genes together in the Xl1-Blue cells so that each possess a T7 promoter, followed by a Lac operator, followed by a ribosome binding site, followed by your open reading frame (T7-LacO-RBS-yORF). However, these multi-gene polypromoter plasmids were unable to be transformed into an expression strain such as BL-21 or Rosetta2. We then figured out that we needed a RecAexpression strain (like Rosetta-Blues) to successfully propagate our polypromoter plasmids. Although Rosetta-Blue cells propagated our plasmids, expression was not so great and we didn't want to rely on a specialized strain to perform our expression. Finally, we figured out that it was the LacO that follows the T7 promoter that was causing plasmid instability in our polypromoter system. Removal of the LacO allowed us to express our polypromoter plasmids in Rosetta2 cells and we have had much success with these plasmids since. Much like our Series- 2 plasmids, the Series-14 plasmids are going to give a substantial amount of leaky expression. However, even with this shortcoming, we have found Series-14 to be a valuable resource for expressing multi-protein complexes. Cloning into the Series-14 plasmids and subsequent biobrick subcloning is performed exactly as described for the Series-9 plasmids. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48310 Copy   

•   Source: Addgene

http://www.addgene.org/48311

Vector Backbone Description: Backbone Size:4151; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable MBP tag on the N-terminus and Amp resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The Series-14 plasmids were designed to overcome the unpredictable expression patterns of genes from a polycistronic message. As mentioned in the Series-2 and Series-9 polycistronic sections, often genes that express well from a single gene mRNA do not express at the same level when placed in a polycistronic message next to other genes. This effect is likely due to mRNA structure interfering with access to the ribosome binding site. When we first made our polypromoter plasmids we found that we could clone multiple genes together in the Xl1-Blue cells so that each possess a T7 promoter, followed by a Lac operator, followed by a ribosome binding site, followed by your open reading frame (T7-LacO-RBS-yORF). However, these multi-gene polypromoter plasmids were unable to be transformed into an expression strain such as BL-21 or Rosetta2. We then figured out that we needed a RecAexpression strain (like Rosetta-Blues) to successfully propagate our polypromoter plasmids. Although Rosetta-Blue cells propagated our plasmids, expression was not so great and we didn't want to rely on a specialized strain to perform our expression. Finally, we figured out that it was the LacO that follows the T7 promoter that was causing plasmid instability in our polypromoter system. Removal of the LacO allowed us to express our polypromoter plasmids in Rosetta2 cells and we have had much success with these plasmids since. Much like our Series- 2 plasmids, the Series-14 plasmids are going to give a substantial amount of leaky expression. However, even with this shortcoming, we have found Series-14 to be a valuable resource for expressing multi-protein complexes. Cloning into the Series-14 plasmids and subsequent biobrick subcloning is performed exactly as described for the Series-9 plasmids. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48311 Copy   

•   Source: Addgene

http://www.addgene.org/48304

Vector Backbone Description: Backbone Size:8937; Vector Backbone:pRS426; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector has a TEV cleavable His6 tag on the N-terminus and can complement Ura auxotrophy. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48304 Copy   

•   Source: Addgene

http://www.addgene.org/48302

Vector Backbone Description: Backbone Size:7773; Vector Backbone:pRS424; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector has a TEV cleavable His6-MBP tag on the N-terminus and can complement Trp auxotrophy. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48302 Copy   

•   Source: Addgene

http://www.addgene.org/48305

Vector Backbone Description: Backbone Size:10092; Vector Backbone:pRS426; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector has a TEV cleavable His6-MBP tag on the N-terminus and can complement Ura auxotrophy. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48305 Copy   

•   Source: Addgene

http://www.addgene.org/48306

Vector Backbone Description: Backbone Size:8878; Vector Backbone:pRS426; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector can complement Ura auxotrophy. Add the following tags to your PCR primers: Note: You must add an ATG to the beginning of your open reading frame. LICvBac Forward Tag TACTTCCAATCCAATCG LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48306 Copy   

•   Source: Addgene

http://www.addgene.org/48262

Species: Saccharomyces cerevisiae
Genetic Insert: TEF1p 5' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Comments: Created by 4-part ligation with XhoI/EagI cut pBluescript II SK (-). Inserts were XhoI/XbaI TEF1p, XbaI/BamHI URA3, and BamHI/EagI TEF1p.

Proper citation: RRID:Addgene_48262 Copy   

•   Source: Addgene

http://www.addgene.org/48300

Vector Backbone Description: Backbone Size:8429; Vector Backbone:pRS422; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector can complement Ade auxotrophy. Add the following tags to your PCR primers: Note: You must add an ATG to the beginning of your open reading frame. LICvBac Forward Tag TACTTCCAATCCAATCG LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48300 Copy   

•   Source: Addgene

http://www.addgene.org/48259

Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Comments: pJH124 was created by cloning an XbaI/XhoI Ag TEF1 promoter fragment into the same sites of vector IpO. The cloned insert was confirmed by DNA sequencing.

Proper citation: RRID:Addgene_48259 Copy   

•   Source: Addgene

http://www.addgene.org/48240

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48240 Copy   

•   Source: Addgene

http://www.addgene.org/48359

Species: T. brucei
Genetic Insert: Partial beta-TUB followed by 5' ALD UTR-loxP-SAS-BLE-Ty1-TK-loxP-3' ALD UTR
Vector Backbone Description: Backbone Marker:Cross Lab; Vector Backbone:pHD309; Vector Types:Cre/Lox, Knockout in T. Brucei; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23954366
Comments: For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab; most notably in the beta-tubulin ORF, HSV thymidine kinase and the T. brucei Aldolase 3'UTR. These mismatches should not affect plasmid function.

Proper citation: RRID:Addgene_48359 Copy   

•   Source: Addgene

http://www.addgene.org/48367

Species: T. brucei
Genetic Insert: FLAG-intergenic region of TUB-HYG (modified from PMID 16269191)
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGEM-T Easy; Vector Types:Cre/Lox, Knockout in T. Brucei; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23954366
Comments: For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab. These mismatches should not affect plasmid function.

Proper citation: RRID:Addgene_48367 Copy   

•   Source: Addgene

http://www.addgene.org/48361

Species: T. brucei
Genetic Insert: Partial beta-TUB followed by 5' ALD UTR-loxP-SAS-HYG-loxP-3' ALD UTR
Vector Backbone Description: Backbone Marker:Cross Lab; Vector Backbone:pHJ17; Vector Types:Cre/Lox, Knockout in T. Brucei; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23954366
Comments: For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab; most notably in the beta-tubulin ORF, HSV thymidine kinase and the T. brucei Aldolase 3'UTR. These mismatches should not affect plasmid function.

Proper citation: RRID:Addgene_48361 Copy   

•   Source: Addgene

http://www.addgene.org/48365

Species: T. brucei
Genetic Insert: 3XMYC-intergenic region of TUB-HYG (modified from PMID 16269191)
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGEM-T Easy; Vector Types:Cre/Lox, Knockout in T. Brucei; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23954366
Comments: For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html

Proper citation: RRID:Addgene_48365 Copy   

•   Source: Addgene

http://www.addgene.org/48639

Species: Homo sapiens
Genetic Insert: hDDB1-BPB
Vector Backbone Description: Backbone Marker:pGex2T; Vector Backbone:pCool; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16413485
Comments: BL21 is recommended for protein overexpression.

Proper citation: RRID:Addgene_48639 Copy   

•   Source: Addgene

http://www.addgene.org/48634

Species: jellyfish
Genetic Insert: roGFP1
Vector Backbone Description: Backbone Size:3418; Vector Backbone:pQE30; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23589496
Comments: This plasmids needs to be amplified and maintained in M15 at all times as this strain has the pREP4 repressor vector that prevents undesired expression (it's important to maintain the plasmid when the protein is not expressed even if it's believed to be inert for the bacteria, to avoid selective pressure in favour of recombinant versions of the gene).

Proper citation: RRID:Addgene_48634 Copy   

•   Source: Addgene

http://www.addgene.org/48631

Species: jellyfish
Genetic Insert: roGFP1
Vector Backbone Description: Backbone Size:3418; Vector Backbone:pQE30; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23589496
Comments: This plasmids needs to be amplified and maintained in M15 at all times as this strain has the pREP4 repressor vector that prevents undesired expression (it's important to maintain the plasmid when the protein is not expressed even if it's believed to be inert for the bacteria, to avoid selective pressure in favour of recombinant versions of the gene).

Proper citation: RRID:Addgene_48631 Copy   

•   Source: Addgene

http://www.addgene.org/48638

Species: Homo sapiens
Genetic Insert: DDB1
Vector Backbone Description: Backbone Marker:Pharmagen; Vector Backbone:pAcGHLT-B; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16413485

Proper citation: RRID:Addgene_48638 Copy   

•   Source: Addgene

http://www.addgene.org/48637

Vector Backbone Description: Backbone Size:5768; Vector Backbone:pCS2; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23667577

Proper citation: RRID:Addgene_48637 Copy   

•   Source: Addgene

http://www.addgene.org/48636

Vector Backbone Description: Backbone Size:5798; Vector Backbone:pCS2; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23667577

Proper citation: RRID:Addgene_48636 Copy   

•   Source: Addgene