Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: CYP450-ExRai-AKAR2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5517; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32989297
Proper citation: RRID:Addgene_161756 Copy
Species: Synthetic
Genetic Insert: GZnP2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5411; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29912548
Proper citation: RRID:Addgene_161739 Copy
Species: Synthetic
Genetic Insert: mGreenLantern
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3999; Vector Backbone:pBAD/His-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33208539
Proper citation: RRID:Addgene_161913 Copy
Species: Synthetic
Genetic Insert: mGreenLantern
Vector Backbone Description: Backbone Size:5410; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33208539
Proper citation: RRID:Addgene_161912 Copy
Species: Synthetic
Genetic Insert: pSB3A5*(BsaI-)-PBAD(SapI-)-tet1-TetR(1-20)-BsaI-BsaI-TetR(188-207)-Ter
Vector Backbone Description: Backbone Marker:Baojun Wang's Lab; Vector Backbone:pSB3A5*(BsaI-); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33850130
Proper citation: RRID:Addgene_161948 Copy
Species: Synthetic
Genetic Insert: pSB3T5(BsaI-)-PBAD(SapI-)-B33-ECF20(1-5)-BsaI-BsaI-ECF20(187-193)-Ter
Vector Backbone Description: Backbone Marker:Baojun Wang's Lab; Vector Backbone:pSB3T5(BsaI-); Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline
Defining Citation: PMID:33850130
Proper citation: RRID:Addgene_161949 Copy
Species: Synthetic
Genetic Insert: pSB1A3-BbsI-GY-gp-41-1N-cat-PPhlF-RiboJ-B32-gp41-1C-SS-SapI
Vector Backbone Description: Backbone Marker:BioBrick; Vector Backbone:pSB1A3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33850130
Proper citation: RRID:Addgene_161940 Copy
Species: Synthetic
Genetic Insert: ABE8e base editor
Vector Backbone Description: Backbone Marker:Atum; Backbone Size:2250; Vector Backbone:pD881-SR; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33462442
Proper citation: RRID:Addgene_161788 Copy
Species: Synthetic
Genetic Insert: pSB1A3-BbsI-10aa-acVHH-T-cat-PBAD(SapI)-RiboJ-BCD22-acVHH-10aa-SapI
Vector Backbone Description: Backbone Marker:BioBrick; Vector Backbone:pSB1A3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33850130
Proper citation: RRID:Addgene_161942 Copy
Species: Synthetic
Genetic Insert: Luciferase-T2A-HSV-TK
Vector Backbone Description: Backbone Marker:Systems Biosciences; Backbone Size:8000; Vector Backbone:pLenti-Luc-2A-Ctx; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31398338
Proper citation: RRID:Addgene_161789 Copy
Species: Synthetic
Genetic Insert: pSB3T5(BsaI-)-PBAD(SapI-)-B33-ECF20-T
Vector Backbone Description: Backbone Marker:Baojun Wang's Lab; Vector Backbone:pSB3T5(BsaI-); Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline
Defining Citation: PMID:33850130
Proper citation: RRID:Addgene_161943 Copy
Species: Synthetic
Genetic Insert: pSB1C3(BsmBI-)-BsaI-mCherry*(27-218)-BsaI
Vector Backbone Description: Backbone Marker:Baojun Wang's Lab; Vector Backbone:pSB1C3(BsmBI-); Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:33850130
Proper citation: RRID:Addgene_161945 Copy
Species: Synthetic
Genetic Insert: pTHSSd_1V-WTR1R2-BbsI(G)-kanR-lacZalpha-SapI-WTR1R2
Vector Backbone Description: Backbone Marker:Christopher Voigt's Lab; Vector Backbone:pTHSSd_1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:33850130
Proper citation: RRID:Addgene_161937 Copy
Species: Synthetic
Genetic Insert: Hypocrates
Vector Backbone Description: Backbone Size:4078; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35013284
Comments: Please visit https://doi.org/10.1101/2021.02.22.432222 for bioRxiv preprint.
Proper citation: RRID:Addgene_161960 Copy
Species: Synthetic
Genetic Insert: pSB3K3-TT-PBAD(SapI-)-B30-His-acVHH-15aa-T7RNAP(181+)-T
Vector Backbone Description: Backbone Marker:BioBrick; Vector Backbone:pSB3K3; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33850130
Proper citation: RRID:Addgene_161955 Copy
Species: Synthetic
Genetic Insert: pSEVA321-PBAD(SapI-)-B30-His-T7RNAP(29-1)-15aa-acVHH-T
Vector Backbone Description: Backbone Marker:The SEVA Commonwealth; Vector Backbone:pSEVA321; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:33850130
Proper citation: RRID:Addgene_161954 Copy
Species: Synthetic
Genetic Insert: HypocratesCS
Vector Backbone Description: Backbone Size:3425; Vector Backbone:pQE-30; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35013284
Comments: Please visit https://doi.org/10.1101/2021.02.22.432222 for bioRxiv preprint.
Proper citation: RRID:Addgene_161957 Copy
Species: Synthetic
Genetic Insert: natR412 guide
Vector Backbone Description: Backbone Size:11240; Vector Backbone:pML104; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34042294
Comments: This plasmid is derived from Addgene plasmid #67638 pML104 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites.
Guide sequence: GTACCGCACCAGTGTCCCGG
Proper citation: RRID:Addgene_162042 Copy
Species: Synthetic
Genetic Insert: kanR468 guide
Vector Backbone Description: Backbone Size:12367; Vector Backbone:pML107; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34042294
Comments: This plasmid is derived from Addgene plasmid #67639 pML107 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites.
Guide sequence: TCCATGTTGGAATTTAATCG
Proper citation: RRID:Addgene_162041 Copy
Species: Synthetic
Genetic Insert: N-terminal tag, HiBiT-MBP-[Factor Xa cleavage site]
Vector Backbone Description: Vector Backbone:pTwist; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34693026
Proper citation: RRID:Addgene_162296 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
