Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: BICDR1
Vector Backbone Description: Backbone Size:4517; Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29420470
Comments: Please note that there are some discrepancies between Addgene's quality control sequence and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
Proper citation: RRID:Addgene_111858 Copy
Species: Homo sapiens
Genetic Insert: KRAS G12C
Vector Backbone Description: Backbone Marker:ATUM; Backbone Size:3936; Vector Backbone:pDNA2.0; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26037647
Proper citation: RRID:Addgene_111848 Copy
Species: Gallus gallus
Genetic Insert: Vinculin-Venus
Vector Backbone Description: Backbone Size:6172; Vector Backbone:pRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29642037
Proper citation: RRID:Addgene_111833 Copy
Species: Gallus gallus
Genetic Insert: VinculinTS
Vector Backbone Description: Backbone Size:6235; Vector Backbone:pRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29642037
Proper citation: RRID:Addgene_111830 Copy
Species: Synthetic
Genetic Insert: GAL4-minimal VP16-EcR
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:pPur; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27673563
Proper citation: RRID:Addgene_111834 Copy
Genetic Insert: None
Vector Backbone Description: Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29348368
Proper citation: RRID:Addgene_112040 Copy
Genetic Insert: Gal DNA binding-estradiol binding-MSN2 activator
Vector Backbone Description: Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29348368
Proper citation: RRID:Addgene_112037 Copy
Species: Homo sapiens
Genetic Insert: NYESO beta/alpha into TRAC HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: AGAGTCTCTCAGCTGGTACA
Proper citation: RRID:Addgene_112021 Copy
Species: Homo sapiens
Genetic Insert: RAB11A-GFP HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: GGTAGTCGTACTCGTCGTCG
Proper citation: RRID:Addgene_112012 Copy
Species: Homo sapiens
Genetic Insert: RAB11A-mCherry HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: GGTAGTCGTACTCGTCGTCG
Proper citation: RRID:Addgene_112013 Copy
Species: Synthetic
Genetic Insert: axon-GCaMP6s-P2A-mRuby3
Vector Backbone Description: Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424
Comments: Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production
Proper citation: RRID:Addgene_112005 Copy
Species: Synthetic
Genetic Insert: axon-GCaMP6s-P2A-mRuby3
Vector Backbone Description: Backbone Size:5109; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424
Proper citation: RRID:Addgene_112008 Copy
Species: Synthetic
Genetic Insert: GCaMP6s-P2A-mKate2
Vector Backbone Description: Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424
Comments: Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production
Proper citation: RRID:Addgene_112006 Copy
Species: Synthetic
Genetic Insert: GCaMP6s-P2A-mRuby3
Vector Backbone Description: Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424
Comments: Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production
Proper citation: RRID:Addgene_112007 Copy
Genetic Insert: Tn5
Vector Backbone Description: Backbone Size:5260; Vector Backbone:pET-45b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30030442
Proper citation: RRID:Addgene_112112 Copy
Species: Synthetic
Genetic Insert: NES-ZapCV2
Vector Backbone Description: Backbone Marker:Invitrogen (ThermoFisher / Life Technologies); Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27959493
Proper citation: RRID:Addgene_112060 Copy
Species: Homo sapiens
Genetic Insert: ABEmax_P2A_GFP
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29813047
Proper citation: RRID:Addgene_112101 Copy
Species: Homo sapiens
Genetic Insert: IGF-1R
Vector Backbone Description: Backbone Size:4888; Vector Backbone:pBabe-bleo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15247278
Comments: The insert was cloned from pcDNA IGF-1R (which contains a 4.2kb IGF-1R insert that lacks about 700bp of 3' sequence. This insert was cloned into the XhoI-XbaI sites of pcDNA). An EcoRI/XbaI fragment of pcDNA-IGF-1R was then inserted into SnaBI site of pBABE-bleo (EcoRI and XbaI sites were blunted).
Proper citation: RRID:Addgene_11212 Copy
Species: Homo sapiens
Genetic Insert: U1
Vector Backbone Description: Backbone Marker: "Reduction of Target Gene Expression by a Modified U1 snRNA" (Beckley et al, 2001, Mol Cell Bio); Vector Backbone:U1 human; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30061719
Comments: In partial sequence, 1 copy of Riboglow (truncated version A)--U1 sequence is in lower case letters, Riboglow sequence is in upper case letters
Proper citation: RRID:Addgene_112059 Copy
Species: Homo sapiens
Genetic Insert: ACTB
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30061719
Comments: 4 copies of Riboglow (variant A), separated by restriction sites as follows: KpnI - A - KpnI - A - BamHI - A - BamHI - A - BamHI
Proper citation: RRID:Addgene_112058 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
