Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
His-ZZ-TEV-SNAPf-BICDR1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_111858 | BICDR1 | Mus musculus | Gentamicin | PMID:29420470 | Please note that there are some discrepancies between Addgene's quality control sequence and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function. | Backbone Size:4517; Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | R250Q, Optimised for Sf9 expression | 2026-08-15 01:01:55 | 1 |
|
pDNA2.0 6H-FLAG-TEV-KRAS G12C Resource Report Resource Website 1+ mentions |
RRID:Addgene_111848 | KRAS G12C | Homo sapiens | Kanamycin | PMID:26037647 | Backbone Marker:ATUM; Backbone Size:3936; Vector Backbone:pDNA2.0; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Changed Glycine 12 to Cysteine | 2026-08-15 01:01:55 | 1 | |
|
pRRL-Vinculin-Venus Resource Report Resource Website 1+ mentions |
RRID:Addgene_111833 | Vinculin-Venus | Gallus gallus | Ampicillin | PMID:29642037 | Backbone Size:6172; Vector Backbone:pRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:55 | 1 | ||
|
pRRL-VinculinTS Resource Report Resource Website 1+ mentions |
RRID:Addgene_111830 | VinculinTS | Gallus gallus | Ampicillin | PMID:29642037 | Backbone Size:6235; Vector Backbone:pRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:55 | 4 | ||
|
pEUI(+) Resource Report Resource Website 1+ mentions |
RRID:Addgene_111834 | GAL4-minimal VP16-EcR | Synthetic | Ampicillin | PMID:27673563 | Backbone Marker:Clonetech; Vector Backbone:pPur; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:55 | 1 | ||
|
pJW1666 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112040 | None | Ampicillin | PMID:29348368 | Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:57 | 1 | |||
|
pJW1663 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112037 | Gal DNA binding-estradiol binding-MSN2 activator | Ampicillin | PMID:29348368 | Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:57 | 3 | |||
|
NYESO beta/alpha into TRAC HDRT Source (pTR 169) Resource Report Resource Website 1+ mentions |
RRID:Addgene_112021 | NYESO beta/alpha into TRAC HDRT | Homo sapiens | Ampicillin | PMID:29995861 | gRNA sequence that can be used with this DNA template: AGAGTCTCTCAGCTGGTACA | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:57 | 1 | |
|
RAB11A-GFP HDRT Source (pTR 143) Resource Report Resource Website 1+ mentions |
RRID:Addgene_112012 | RAB11A-GFP HDRT | Homo sapiens | Ampicillin | PMID:29995861 | gRNA sequence that can be used with this DNA template: GGTAGTCGTACTCGTCGTCG | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:57 | 5 | |
|
RAB11A-mCherry HDRT Source (pTR 144) Resource Report Resource Website 1+ mentions |
RRID:Addgene_112013 | RAB11A-mCherry HDRT | Homo sapiens | Ampicillin | PMID:29995861 | gRNA sequence that can be used with this DNA template: GGTAGTCGTACTCGTCGTCG | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:57 | 2 | |
|
pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112005 | axon-GCaMP6s-P2A-mRuby3 | Synthetic | Ampicillin | PMID:30127424 | Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production | Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:57 | 7 | |
|
pAAV-hSynapsin1-FLEx-axon-GCaMP6s-P2A-mRuby3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112008 | axon-GCaMP6s-P2A-mRuby3 | Synthetic | Ampicillin | PMID:30127424 | Backbone Size:5109; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:57 | 4 | ||
|
pAAV-hSynapsin1-GCaMP6s-P2A-mKate2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112006 | GCaMP6s-P2A-mKate2 | Synthetic | Ampicillin | PMID:30127424 | Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production | Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:57 | 1 | |
|
pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112007 | GCaMP6s-P2A-mRuby3 | Synthetic | Ampicillin | PMID:30127424 | Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production | Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:57 | 1 | |
|
pET-45b(+)-Tn5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112112 | Tn5 | Ampicillin | PMID:30030442 | Backbone Size:5260; Vector Backbone:pET-45b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | E54K E110K P242A L372P | 2026-08-15 01:01:58 | 4 | ||
|
pcDNA3.1(+)-NES-ZapCV2 (cpV143) Resource Report Resource Website 1+ mentions |
RRID:Addgene_112060 | NES-ZapCV2 | Synthetic | Ampicillin | PMID:27959493 | Backbone Marker:Invitrogen (ThermoFisher / Life Technologies); Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | ECFP gene is truncated 36 bp at 3' end. Venus gene is circurlarly permuted at residue 173. Zap2 zinc binding domain derived from S. cerevisiae Zap1 zinc finger domains 1 & 2 with C581H and C618H mutations. | 2026-08-15 01:01:57 | 3 | |
|
pCMV_ABEmax_P2A_GFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_112101 | ABEmax_P2A_GFP | Homo sapiens | Ampicillin | PMID:29813047 | Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:57 | 44 | ||
|
pBABE-bleo IGF-1R Resource Report Resource Website 10+ mentions |
RRID:Addgene_11212 | IGF-1R | Homo sapiens | Ampicillin | PMID:15247278 | The insert was cloned from pcDNA IGF-1R (which contains a 4.2kb IGF-1R insert that lacks about 700bp of 3' sequence. This insert was cloned into the XhoI-XbaI sites of pcDNA). An EcoRI/XbaI fragment of pcDNA-IGF-1R was then inserted into SnaBI site of pBABE-bleo (EcoRI and XbaI sites were blunted). | Backbone Size:4888; Vector Backbone:pBabe-bleo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:58 | 14 | |
|
AT-U1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112059 | U1 | Homo sapiens | Ampicillin | PMID:30061719 | In partial sequence, 1 copy of Riboglow (truncated version A)--U1 sequence is in lower case letters, Riboglow sequence is in upper case letters | Backbone Marker: "Reduction of Target Gene Expression by a Modified U1 snRNA" (Beckley et al, 2001, Mol Cell Bio); Vector Backbone:U1 human; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 1 copy of Riboglow tag (truncated variant A) near 5' end of U1 | 2026-08-15 01:01:57 | 2 |
|
ACTB-(A)4x Resource Report Resource Website 1+ mentions |
RRID:Addgene_112058 | ACTB | Homo sapiens | Kanamycin | PMID:30061719 | 4 copies of Riboglow (variant A), separated by restriction sites as follows: KpnI - A - KpnI - A - BamHI - A - BamHI - A - BamHI | Backbone Marker:Clontech; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 4 copies of Riboglow tag after stop codon | 2026-08-15 01:01:57 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
