Plasmids   Select Another Resource Report Type

http://www.addgene.org/115924

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29765036
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-sulA-GFP Integration at HK022 attB: pOSIP-KO-RBS2-dCas9 SulA-GFP acts as an SOS response reporter.

Proper citation: RRID:Addgene_115924 Copy   

•   Source: Addgene

http://www.addgene.org/115926

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29765036
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-KO-RBS2-dCas9 mCherry quantifies dCas9 repression

Proper citation: RRID:Addgene_115926 Copy   

•   Source: Addgene

http://www.addgene.org/141407

Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:31980824
Comments: λ- F- glnX44 e14- (McrA-) rfbD1 endA1 thi-1 Δ(yjiT-opgB)114::IS10 (EcoKI R- M- McrBC- Mrr-) + rpoS393(am) creC510 lrhA::IS3 ydeN::IS10 ΔlacI Verification of lacI deletion: PCR reaction on genomic DNA using AK362 and AK365 primers produces a 1936 bp fragment AK 362 5’-CAATACCAATCGCACGCGG AK 365 5’-CGAGACGTCACGGAAAATGCC Phenotype: Constitutive β-galactosidase synthesis This strain was derived from the precursor strain, E. coli ER1821, which is described in Jobling et al. (2016) Complete Genome Sequence of Escherichia coli ER1821R, a Laboratory K-12 Derivative Engineered To Be Deficient in All Methylcytosine and Methyladenine Restriction Systems. Genome Announc 4(4):e00763-16. https://www.ncbi.nlm.nih.gov/pubmed/27516504

Proper citation: RRID:Addgene_141407 Copy   

•   Source: Addgene

http://www.addgene.org/134836

Genetic Insert: lysogen of a temperature-inducible bacteriophage lambda
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:28522818
Comments: Genotype is [λ+ Lac- galK2 IN(rrnD-rrnE)1 rph-1], a derivative of strain W3102 Phenotypic assay: Grow at 30°C, but restricted at 42°C due to the induction of phage particles and cell lysis.

Proper citation: RRID:Addgene_134836 Copy   

•   Source: Addgene

http://www.addgene.org/34929

Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21868676
Comments: To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain BL21. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy.

Proper citation: RRID:Addgene_34929 Copy   

•   Source: Addgene

http://www.addgene.org/21875

Genetic Insert: CSH100 bacterial Strain
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:19798082
Comments: F’ lac proA+proB+(lacIq lacPL8)/ara- ∆(gpt-lac)5 This strain will be shipped as bacteria in an LB stab. Upon receipt, requesting scientists should restreak the strain on an M9 minimal plate. After restreaking on M9 to confirm the presence of the F', scientists can grow the strain in liquid LB. M9 minimal medium agar plates: To prepare 500 ml, autoclave 439 ml H2O with 7.5 g Bacto-agar and a stir bar. When agar has cooled to approximately 65°C, add 50 ml 10X M9 salts, 1 ml 1 M MgSO4, 10 ml 20% (w/v) glucose and 0.5 ml 100mM CaCl2 and then pour plates. Plates can be stored indefinitely at 4°C in sealed plastic bags. (Alternatively, M9 plates can be purchased from Teknonva: https://www.teknova.com/content/teknova/us/en/products/product-page.html/m1260.html).

Proper citation: RRID:Addgene_21875 Copy   

•   Source: Addgene

http://www.addgene.org/197112

Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Comments: E. coli MEV15 is engineered to host sesquiterpenoid biosynthetic pathways. Sesquiterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Sesquiterpenoid production can be induced by IPTG, vanillic aci, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and E. coli ispA inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing.

Proper citation: RRID:Addgene_197112 Copy   

•   Source: Addgene

http://www.addgene.org/197934

Genetic Insert: RNA polymerase gene (T7 phage)/chromosome
Vector Backbone Description: Vector Backbone:BL21(DE3); Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:25982672
Comments: Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons, disruption of prfA, and frameshift in fabR.

Proper citation: RRID:Addgene_197934 Copy   

•   Source: Addgene

http://www.addgene.org/200839

Species: Escherichia coli str. K-12 substr. MG1655
Genetic Insert: Genotype: MG1655 rph+, ilvG+, ΔlacZ
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:20952573
Comments: Corresponding wild-type strain (rapZ+, glmZ+, glmY+) for strain Z956 (Addgene Bacterial strain #200838).

Proper citation: RRID:Addgene_200839 Copy   

•   Source: Addgene

http://www.addgene.org/188474

Genetic Insert: P-R-lox-TT-lox-bla
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188474 Copy   

•   Source: Addgene

http://www.addgene.org/188475

Genetic Insert: P-R-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188475 Copy   

•   Source: Addgene

http://www.addgene.org/188476

Genetic Insert: P*-R-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188476 Copy   

•   Source: Addgene

http://www.addgene.org/172602

Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:34369028
Comments: The BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays (after growing transformed cells on MOPS media). Plasmids encoding these chimeras are found at https://www.addgene.org/browse/article/28216962/.  The protocol for the reporter assay is detailed in the manuscript. The genotype for BW-Para is [F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ-, rph-1, Δ(rhaD-rhaB)568, hsdR514], ΔlacI785::kan, ΔaraC771::kan, ΔrhaSR::(PBADmut:lacZ)].  The PBADmut:lacZ reporter construct integrated into the rhaSR KO locus comprises a synthetic Para-I promoter with -10/-35 sites of GATACT/TTTACA respectively and an ara-I DNA binding site proximal to the -35 site.  The integrated 3.5 kb cassette coding for the reporter construct can be amplified from the genome using the primers: (forward) 5' - GGTGAAAGTTGGAACCTCTTAC - 3' and (reverse) 5'- GCGAGGAAGCGGAATATATCCCC - 3'. Cells should be freshly transformed prior to each assay.

Proper citation: RRID:Addgene_172602 Copy   

•   Source: Addgene

http://www.addgene.org/83379

Species: Mus musculus
Genetic Insert: Forkhead box O1
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None

Proper citation: RRID:Addgene_83379 Copy   

•   Source: Addgene

http://www.addgene.org/61151

Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:23479654
Comments: In addition to the wt copy of lacI, another copy of lacI driven by PIq is integrated at the attB Contains another copy of araC driven by a constitutive promoter in addition to wt araC.

Proper citation: RRID:Addgene_61151 Copy   

•   Source: Addgene

http://www.addgene.org/61162

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:22833608
Comments: MG1655 + PLlacO-1::T710::yfp intergrated at galK

Proper citation: RRID:Addgene_61162 Copy   

•   Source: Addgene

http://www.addgene.org/61161

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:22833608
Comments: HL1745 + PLlacO-1::T710::yfp intergrated at galK

Proper citation: RRID:Addgene_61161 Copy   

•   Source: Addgene

http://www.addgene.org/61166

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:22833608
Comments: MG1655 + PLlacO-1::T710::yfp intergrated at yjiP + ∆lacI

Proper citation: RRID:Addgene_61166 Copy   

•   Source: Addgene

http://www.addgene.org/61165

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:22833608
Comments: MG1655 + PLlacO-1::T710::yfp intergrated at yfjV + ∆lacI

Proper citation: RRID:Addgene_61165 Copy   

•   Source: Addgene

http://www.addgene.org/61917

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = cyo ilvE avtA aspC hisG argH Precursor strain = ML23 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61917 Copy   

•   Source: Addgene