Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: LuxR-tdKatushka2
Vector Backbone Description: Vector Backbone:pFLxTd5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34125913
Proper citation: RRID:Addgene_167519 Copy
Species: Synthetic
Genetic Insert: LuxR-Violacein
Vector Backbone Description: Vector Backbone:pBLxVi5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34125913
Proper citation: RRID:Addgene_167516 Copy
Species: Tetrahymena thermophila
Genetic Insert: Q22YU3 C-terminal truncation (Delta-C3)
Vector Backbone Description: Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33632841
Proper citation: RRID:Addgene_170316 Copy
Species: Arabidopsis thaliana
Genetic Insert: ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34059917
Comments: For use with Three-way Multi-site Gateway Cloning (Invitrogen).
Proper citation: RRID:Addgene_170723 Copy
Species: Aspergillus nidulans
Genetic Insert: Rhamnogalacturonan lyase B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34059917
Comments: For use with Three-way Multi-site Gateway Cloning (Invitrogen).
Proper citation: RRID:Addgene_170721 Copy
Species: Aspergillus nidulans
Genetic Insert: Pectin lyase A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34059917
Comments: For use with Three-way Multi-site Gateway Cloning (Invitrogen).
Proper citation: RRID:Addgene_170722 Copy
Species: Arabidopsis thaliana
Genetic Insert: ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34059917
Comments: For use with Three-way Multi-site Gateway Cloning (Invitrogen).
Proper citation: RRID:Addgene_170725 Copy
Species: Synthetic
Genetic Insert: J306 scRNA
Vector Backbone Description: Backbone Marker:Jesse Zalatan; Backbone Size:6261; Vector Backbone:pPPC020.306; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33930546
Comments: Alternative names: pCK162, pBBR1-GmR_J3-BBa_J23117-mvaES
Proper citation: RRID:Addgene_171151 Copy
Species: Synthetic
Genetic Insert: J306 scRNA
Vector Backbone Description: Backbone Marker:Jesse Zalatan; Backbone Size:6261; Vector Backbone:pPPC020.306; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33930546
Comments: Alternative names: pCK134, pBBR1-GmR_J3-BBa_J23117-GTPCH_J3-BBa_J23117-PTPS_J3-BBa_J23117-SR
Proper citation: RRID:Addgene_171149 Copy
Species: Synthetic
Genetic Insert: J1-BBa_J23117-sfGFP
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18TminiTn7T-Gm; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33930546
Comments: Alternative names: pCDP009, pUC18TminiTn7T-Gm_J1-BBa_J23117-sfGFP_Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A/S101A)
Used for conjugation, with pTNS1 and pRK2013 helper plasmids, to integrate J1-BBa_J23117-sfGFP, Sp.pCas9-dCas9, and BBa_J23107-MCP-SoxS(R93A/S101A) cassettes into gram-negative bacteria.
Point mutation in the FRT site was observed and remained applicable with counterselection by pCK255
Proper citation: RRID:Addgene_171139 Copy
Species: Homo sapiens
Genetic Insert: MZT2A
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178074 Copy
Species: Homo sapiens
Genetic Insert: GCP5
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178071 Copy
Species: Homo sapiens
Genetic Insert: GCP6
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178072 Copy
Species: Homo sapiens
Genetic Insert: gamma-tubulin with an N229A point mutation
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Comments: Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG
Proper citation: RRID:Addgene_178077 Copy
Species: Homo sapiens
Genetic Insert: MZT1
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178075 Copy
Species: Homo sapiens
Genetic Insert: beta-actin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178076 Copy
Species: Homo sapiens
Genetic Insert: gamma-tubulin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178067 Copy
Species: Synthetic
Genetic Insert: mScarlet counter-selection cassette
Vector Backbone Description: Backbone Size:2607; Vector Backbone:BASIC_SEVA_67.10; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:36381610
Comments: Cloning method: BASIC DNA assembly . Please visit https://www.biorxiv.org/content/10.1101/2022.01.06.446575v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_178940 Copy
Species: Lobophyllia hemprichii
Genetic Insert: mEos3.2
Vector Backbone Description: Vector Backbone:pMT85-2res; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35638916
Proper citation: RRID:Addgene_173894 Copy
Species: Lobophyllia hemprichii
Genetic Insert: mEos3.2
Vector Backbone Description: Vector Backbone:pMT85-2res; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35638916
Proper citation: RRID:Addgene_173895 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
