Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Gallus gallus
Genetic Insert: Vcl 884-1066 (Vt)
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: PstI-ApaI fragment of pGEX3TV884-1066 subcloned into Pst-Apa cut pEGFP-C3)EGFP.
Proper citation: RRID:Addgene_46272 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-258 (aka VD1)
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16608855
Comments: Nde-Xho fragment from pET15b/Vh1-258 (Addgene plasmid 46173) was subcloned into EGFP/V1-1066 (Addgene plasmid 46265) vector modified to contain unique Nde, Xho sites. Modifications were made by QuikChange PCR to facilitate cloning of cDNAs previously in the pET15b vector. The NdeI site present in the cytomegalovirus promoter region was removed (mutating adenine 234 to thymine), and
a new NdeI site was introduced into the multiple cloning site immediately before the vinculin start codon. Additionally, the 5-XhoI site was removed (mutating cytosine 1345 to adenine), and a 3-XhoI site was introduced 3' to the vinculin cDNA in lieu of a PstI site.
Proper citation: RRID:Addgene_46270 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-851 A50I mutation
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16608855
Comments: A50I mutation introduced into EGFP/V1-851 (Addgene plasmid 46268) by QCPCR mutation.
Proper citation: RRID:Addgene_46269 Copy
Species: Gallus gallus
Genetic Insert: Vcl T12 mutant
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15728584
Comments: T12 mutation introduced by QuikChange PCR to Addgene plasmid 46265.
Mutant inhibits vinculin autoinhibition by ~ 100 fold, vinculin is partially activated and will bind talin, but not actin (unless both talin and actin are present at same time).
Proper citation: RRID:Addgene_46266 Copy
Species: Gallus gallus
Genetic Insert: Vcl
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Chicken vinculin, full length(EcoRI fragment of p1005 subcloned into EcoRI-cut pEGFP-C1); A50I mutation (alanine 50 to isoleucine) introduced by QCPCR.
This mutant binds poorly (undetectably to talin in pull down assays; sensitivity of assay Kd= 10-20 uM).
Proper citation: RRID:Addgene_46267 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-851
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15728584
Comments: EYFP was PCR amplified to introduce NdeI site at both 5' and 3' ends. The NdeI flanked EYFP was inserted into NdeI site of pET15b/Vh1-851 (Addgene plasmid 46172), cloned between NdeI and XhoI. Plasmid contains a 12-residue spacer between the EYFP and vinculin domain.
Proper citation: RRID:Addgene_46264 Copy
Species: Gallus gallus
Genetic Insert: Vcl
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15728584
Comments: full length chicken vinculin (EcoRI fragment of p1005 subcloned into EcoRI-cut pEGFP-C1). ATG at bp 1390-1392. TAA at bp 4588-90. EGFP at N-terminus.
Proper citation: RRID:Addgene_46265 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-258
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15728584
Comments: EYFP was PCR amplified to introduce NdeI site at both 5' and 3' ends. The NdeI flanked EYFP was inserted into NdeI site of pET15b/Vh1-258 (Addgene plasmid 46173), where V1-258 was cloned between NdeI and XhoI. Plasmid contains a 12-residue spacer between the EYFP and vinculin domain.
Proper citation: RRID:Addgene_46263 Copy
Species: Gallus gallus
Genetic Insert: Vcl 884-1066
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: YFP subcloned into 15b/V884-1066 (Addgene plasmid 46176) via a PCR strategy which placed Nde sites at the ends of the YFP cDNA and added the spacer region in EGFPC1/V1-1066 at the Cterminus of YFP.
Proper citation: RRID:Addgene_46181 Copy
Species: Gallus gallus
Genetic Insert: Vcl 884-1066
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_46182 Copy
Species: Gallus gallus
Genetic Insert: BMPR-1B DN
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2959; Vector Backbone:pBluescript SK+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9303535
Comments: The BMPR-1B insert in this plasmid contains P2A, M11V and S18G mutations when compared to GenBank reference sequence NP_990463.1. These mutations are not a concern for the function of the plasmid, as described in the associated publication.
Proper citation: RRID:Addgene_49529 Copy
Species: Gallus gallus
Genetic Insert: BMPR-1B CA
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2959; Vector Backbone:pBluescript SK+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9527884
Comments: The BMPR-1B insert in this plasmid contains P2A, M11V and S18G mutations when compared to GenBank reference sequence NP_990463.1. These mutations are not a concern for the function of the plasmid, as described in the associated publication.
Proper citation: RRID:Addgene_49528 Copy
Species: Gallus gallus
Genetic Insert: SIINFEKL
Vector Backbone Description: Backbone Size:8200; Vector Backbone:PresentER; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30499773
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/22/267047 for bioRxiv preprint.
Proper citation: RRID:Addgene_102945 Copy
Species: Gallus gallus
Genetic Insert: TVA + Puro
Vector Backbone Description: Backbone Size:5720; Vector Backbone:MMLV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36040301
Comments: Please visit https://doi.org/10.1101/2021.12.23.474014 for bioRxiv preprint.
Proper citation: RRID:Addgene_172366 Copy
Species: Gallus gallus
Genetic Insert: v-src
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2161957
Proper citation: RRID:Addgene_17670 Copy
Species: Gallus gallus
Genetic Insert: c-src Y416F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3103925
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17676 Copy
Species: Gallus gallus
Genetic Insert: c-src K295R
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1702522
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17678 Copy
Species: Gallus gallus
Genetic Insert: c-src K295R Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1702522
Comments: Based on plasmid pM5HHB5. This plasmid is unpublished, but related to this article.
Proper citation: RRID:Addgene_17679 Copy
Species: Gallus gallus
Genetic Insert: c-src S12A
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2474754
Comments: The pM5HHB5 c-src sequence between nucleotide 1 (numbering from the c-src translational initiator ATG) and nucleotide 43 (at an NaeI site) was replaced with the sequence ATGGGGAGTAGCAAGAGCAAGCCTAAGGATC
CCGCTCAGCGCC in pcAlal2. This introduced MstII and BamHI restriction sites near
nucleotides 25 and 29, respectively, and changed the AGC (Ser) 12 codon to GCT (Ala) codon yet preserved the remaining the c-src amino acid sequence.
Proper citation: RRID:Addgene_17680 Copy
Species: Gallus gallus
Genetic Insert: c-src S12A S17A
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2474754
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17682 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
