Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
LC-E18 Resource Report Resource Website |
RRID:Addgene_115924 | none | None | PMID:29765036 | E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-sulA-GFP Integration at HK022 attB: pOSIP-KO-RBS2-dCas9 SulA-GFP acts as an SOS response reporter. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:02:39 | 0 | ||
|
AV04 Resource Report Resource Website |
RRID:Addgene_115926 | none | None | PMID:29765036 | E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-KO-RBS2-dCas9 mCherry quantifies dCas9 repression | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:02:38 | 0 | ||
|
E. coli ER1821ΔlacI Resource Report Resource Website |
RRID:Addgene_141407 | None | PMID:31980824 | λ- F- glnX44 e14- (McrA-) rfbD1 endA1 thi-1 Δ(yjiT-opgB)114::IS10 (EcoKI R- M- McrBC- Mrr-) + rpoS393(am) creC510 lrhA::IS3 ydeN::IS10 ΔlacI Verification of lacI deletion: PCR reaction on genomic DNA using AK362 and AK365 primers produces a 1936 bp fragment AK 362 5’-CAATACCAATCGCACGCGG AK 365 5’-CGAGACGTCACGGAAAATGCC Phenotype: Constitutive β-galactosidase synthesis This strain was derived from the precursor strain, E. coli ER1821, which is described in Jobling et al. (2016) Complete Genome Sequence of Escherichia coli ER1821R, a Laboratory K-12 Derivative Engineered To Be Deficient in All Methylcytosine and Methyladenine Restriction Systems. Genome Announc 4(4):e00763-16. https://www.ncbi.nlm.nih.gov/pubmed/27516504 | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:06:48 | 0 | |||
|
IF189 Resource Report Resource Website |
RRID:Addgene_134836 | lysogen of a temperature-inducible bacteriophage lambda | None | PMID:28522818 | Genotype is [λ+ Lac- galK2 IN(rrnD-rrnE)1 rph-1], a derivative of strain W3102 Phenotypic assay: Grow at 30°C, but restricted at 42°C due to the induction of phage particles and cell lysis. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:05:48 | 0 | ||
|
BL21∆serB Resource Report Resource Website 1+ mentions |
RRID:Addgene_34929 | None | PMID:21868676 | To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain BL21. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy. | Vector Backbone:None; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:13:56 | 5 | |||
|
Strain CSH100 Resource Report Resource Website |
RRID:Addgene_21875 | CSH100 bacterial Strain | None | PMID:19798082 | F’ lac proA+proB+(lacIq lacPL8)/ara- ∆(gpt-lac)5 This strain will be shipped as bacteria in an LB stab. Upon receipt, requesting scientists should restreak the strain on an M9 minimal plate. After restreaking on M9 to confirm the presence of the F', scientists can grow the strain in liquid LB. M9 minimal medium agar plates: To prepare 500 ml, autoclave 439 ml H2O with 7.5 g Bacto-agar and a stir bar. When agar has cooled to approximately 65°C, add 50 ml 10X M9 salts, 1 ml 1 M MgSO4, 10 ml 20% (w/v) glucose and 0.5 ml 100mM CaCl2 and then pour plates. Plates can be stored indefinitely at 4°C in sealed plastic bags. (Alternatively, M9 plates can be purchased from Teknonva: https://www.teknova.com/content/teknova/us/en/products/product-page.html/m1260.html). | Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:12:06 | 0 | ||
|
E. coli MEV15 Resource Report Resource Website |
RRID:Addgene_197112 | None | E. coli MEV15 is engineered to host sesquiterpenoid biosynthetic pathways. Sesquiterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Sesquiterpenoid production can be induced by IPTG, vanillic aci, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and E. coli ispA inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing. | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:26:59 | 0 | ||||
|
B-95.ΔAΔfabR Resource Report Resource Website 1+ mentions |
RRID:Addgene_197934 | RNA polymerase gene (T7 phage)/chromosome | None | PMID:25982672 | Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons, disruption of prfA, and frameshift in fabR. | Vector Backbone:BL21(DE3); Vector Types:; Bacterial Resistance:None | 2026-08-15 01:25:28 | 1 | ||
|
S4197 Resource Report Resource Website |
RRID:Addgene_200839 | Genotype: MG1655 rph+, ilvG+, ΔlacZ | Escherichia coli str. K-12 substr. MG1655 | None | PMID:20952573 | Corresponding wild-type strain (rapZ+, glmZ+, glmY+) for strain Z956 (Addgene Bacterial strain #200838). | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:27:15 | 0 | |
|
MG1655-OptoCre-bla-P-R Resource Report Resource Website |
RRID:Addgene_188474 | P-R-lox-TT-lox-bla | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:25:09 | 0 | ||
|
MG1655-OptoCre-knt-P-R Resource Report Resource Website |
RRID:Addgene_188475 | P-R-lox-TT-lox-knt | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:25:12 | 0 | ||
|
MG1655-OptoCre-knt-P*-R Resource Report Resource Website |
RRID:Addgene_188476 | P*-R-lox-TT-lox-knt | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:25:09 | 0 | ||
|
BW-Para Resource Report Resource Website |
RRID:Addgene_172602 | None | PMID:34369028 | The BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays (after growing transformed cells on MOPS media). Plasmids encoding these chimeras are found at https://www.addgene.org/browse/article/28216962/. The protocol for the reporter assay is detailed in the manuscript. The genotype for BW-Para is [F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ-, rph-1, Δ(rhaD-rhaB)568, hsdR514], ΔlacI785::kan, ΔaraC771::kan, ΔrhaSR::(PBADmut:lacZ)]. The PBADmut:lacZ reporter construct integrated into the rhaSR KO locus comprises a synthetic Para-I promoter with -10/-35 sites of GATACT/TTTACA respectively and an ara-I DNA binding site proximal to the -35 site. The integrated 3.5 kb cassette coding for the reporter construct can be amplified from the genome using the primers: (forward) 5' - GGTGAAAGTTGGAACCTCTTAC - 3' and (reverse) 5'- GCGAGGAAGCGGAATATATCCCC - 3'. Cells should be freshly transformed prior to each assay. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:24:37 | 0 | |||
|
pSELECT-HA-mFOXO1-D256 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83379 | Forkhead box O1 | Mus musculus | None | Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None | N256TAG (premature stop codon) | 2026-08-15 01:21:07 | 1 | ||
|
DH10B-ALT Resource Report Resource Website |
RRID:Addgene_61151 | None | PMID:23479654 | In addition to the wt copy of lacI, another copy of lacI driven by PIq is integrated at the attB Contains another copy of araC driven by a constitutive promoter in addition to wt araC. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:17:39 | 0 | |||
|
HL 1951 Resource Report Resource Website |
RRID:Addgene_61162 | See comments | None | PMID:22833608 | MG1655 + PLlacO-1::T710::yfp intergrated at galK | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:17:39 | 0 | ||
|
HL 1852 Resource Report Resource Website |
RRID:Addgene_61161 | See comments | None | PMID:22833608 | HL1745 + PLlacO-1::T710::yfp intergrated at galK | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:17:39 | 0 | ||
|
HL 5222 Resource Report Resource Website |
RRID:Addgene_61166 | See comments | None | PMID:22833608 | MG1655 + PLlacO-1::T710::yfp intergrated at yjiP + ∆lacI | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:17:39 | 0 | ||
|
HL 5221 Resource Report Resource Website |
RRID:Addgene_61165 | See comments | None | PMID:22833608 | MG1655 + PLlacO-1::T710::yfp intergrated at yfjV + ∆lacI | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:17:39 | 0 | ||
|
ML26 Resource Report Resource Website |
RRID:Addgene_61917 | none | None | PMID:21925267 | Genotype = cyo ilvE avtA aspC hisG argH Precursor strain = ML23 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:17:47 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
