Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
39R861+ Resource Report Resource Website |
RRID:Addgene_119737 | None | PMID:30738800 | Strain can be grown on LB without antibiotics. Resistant to: ampicillin, chloramphenicol, florfenicol, gentamicin, kanamycin, nalidixic acid, streptomycin, spectinomycin, sulphonamides, tobramycin, tetracycline, trimethoprim Please note that plasmids are stable in the absence of antibiotic selection. 39R861+ is resistant to nalidixic acid due to a chromosomal mutation. The remaining resistance determinants are plasmid-borne. 39R861+ contains six plasmids, outlined in the supplemental files. | Vector Backbone:See supplemental files for plasmid details; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:21:08 | 0 | |||
|
IF189 Resource Report Resource Website |
RRID:Addgene_134836 | lysogen of a temperature-inducible bacteriophage lambda | None | PMID:28522818 | Genotype is [λ+ Lac- galK2 IN(rrnD-rrnE)1 rph-1], a derivative of strain W3102 Phenotypic assay: Grow at 30°C, but restricted at 42°C due to the induction of phage particles and cell lysis. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:23:43 | 0 | ||
|
E. coli ER1821ΔlacI Resource Report Resource Website |
RRID:Addgene_141407 | None | PMID:31980824 | λ- F- glnX44 e14- (McrA-) rfbD1 endA1 thi-1 Δ(yjiT-opgB)114::IS10 (EcoKI R- M- McrBC- Mrr-) + rpoS393(am) creC510 lrhA::IS3 ydeN::IS10 ΔlacI Verification of lacI deletion: PCR reaction on genomic DNA using AK362 and AK365 primers produces a 1936 bp fragment AK 362 5’-CAATACCAATCGCACGCGG AK 365 5’-CGAGACGTCACGGAAAATGCC Phenotype: Constitutive β-galactosidase synthesis This strain was derived from the precursor strain, E. coli ER1821, which is described in Jobling et al. (2016) Complete Genome Sequence of Escherichia coli ER1821R, a Laboratory K-12 Derivative Engineered To Be Deficient in All Methylcytosine and Methyladenine Restriction Systems. Genome Announc 4(4):e00763-16. https://www.ncbi.nlm.nih.gov/pubmed/27516504 | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:24:39 | 0 | |||
|
BL21 ΔrecBCD Resource Report Resource Website |
RRID:Addgene_176581 | This is a strain. | None | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None | recBCD genomic deletion | Addgene | 2026-09-26 02:28:59 | 0 | |
|
BL21∆serB Resource Report Resource Website 1+ mentions |
RRID:Addgene_34929 | None | PMID:21868676 | To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain BL21. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy. | Vector Backbone:None; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:31:58 | 5 | |||
|
BLIM cells Resource Report Resource Website 1+ mentions |
RRID:Addgene_35609 | none | None | PMID:10610690 | To be used with the following plasmids from the Matthews lab: pTARA (www.addgene.org/31491), pLS1 (www.addgene.org/31490), and (www.addgene.org/31492) pLS1/-11 | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:32:05 | 1 | ||
|
MG1655 ΔendA ΔrecA Resource Report Resource Website |
RRID:Addgene_37853 | None | PMID:20643967 | Vector Backbone:N/A; Vector Types:E. coli bacterial strain; Bacterial Resistance:None | Addgene | 2026-09-26 02:32:23 | 0 | ||||
|
MG1655 ΔendA ΔrecA (DE3) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37854 | None | PMID:21110891 | Vector Backbone:N/A; Vector Types:E. coli bacterial strain; Bacterial Resistance:None | Addgene | 2026-09-26 02:32:23 | 8 | ||||
|
JM109 Resource Report Resource Website 1+ mentions |
RRID:Addgene_49761 | Relevant genotype: recA1, endA1, gyrA96, thi, hsdR17, supE44, relA1, λ-, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15] | None | PMID:2985470 | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:10 | 4 | |||
|
JM107 Resource Report Resource Website |
RRID:Addgene_49759 | Relevant genotype: endA1, gyrA96, thi, hsdR17, supE44, relA1, λ-, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15] | E.coli | None | PMID:2985470 | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:10 | 0 | ||
|
JM106 Resource Report Resource Website |
RRID:Addgene_49757 | Relevant genotype: endA1, gyrA96, thi, hsdR17, supE44, relA1, λ-, Δ(lac-proAB) | E.coli | None | PMID:2985470 | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:10 | 0 | ||
|
JM101 Resource Report Resource Website |
RRID:Addgene_50349 | Relevant genotype: supE, thi, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15] | E. coli | None | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:14 | 0 | |||
|
JM83 Resource Report Resource Website |
RRID:Addgene_50348 | Relevant genotype: ara, Δ(lac-proAB), rspL(+strA), ϕ80, lacZΔM15 | E. coli | None | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:14 | 0 | |||
|
KI (37)-Oplac2 Resource Report Resource Website |
RRID:Addgene_52704 | KI (37)-Oplac2 strain | None | PMID:22605776 | To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of Oplac2 with those of KIlac, producing and KI(37)-Oplac2. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | ||
|
degtag Resource Report Resource Website |
RRID:Addgene_52705 | degtag strain | None | PMID:22605776 | To generate the degtag strain, we introduced the ssrA tag to the C-terminus of LacZ, thus targeting the protein for degradation by the ClpXP and ClpAP proteases. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | ||
|
KI (37)-Oplac1 Resource Report Resource Website |
RRID:Addgene_52703 | KI (37)-Oplac1 strain | None | PMID:22605776 | To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of OpLac1 with those of KIlac. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | ||
|
OpLac2-delta-6 Resource Report Resource Website |
RRID:Addgene_52700 | OpLac2-Δ6 strain | None | PMID:22605776 | Oplac2Δ6 was erroneously synthesized missing the first 6 nucleotides of Oplac2. These deletions correspond to the first 2 N-terminal amino acid residues (Methionine and Threonine), and instead begin at the Methionine at position 3. | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | ||
|
Oplac1 (37)-KI Resource Report Resource Website |
RRID:Addgene_52701 | Oplac1 (37)-KI strain | None | PMID:22605776 | To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of KILac with those of OpLac1. | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | ||
|
S56L Resource Report Resource Website |
RRID:Addgene_52709 | S56L strain | None | PMID:22605776 | Impaired LacY function | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | ||
|
delta-Z Resource Report Resource Website 1+ mentions |
RRID:Addgene_52706 | ΔZ strain | None | PMID:22605776 | lacZ deletion | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
