Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 2 showing 21 ~ 40 out of 199 results
Snippet view Table view Download 199 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_119737

http://www.addgene.org/119737

Vector Backbone Description: Vector Backbone:See supplemental files for plasmid details; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:30738800
Comments: Strain can be grown on LB without antibiotics. Resistant to: ampicillin, chloramphenicol, florfenicol, gentamicin, kanamycin, nalidixic acid, streptomycin, spectinomycin, sulphonamides, tobramycin, tetracycline, trimethoprim Please note that plasmids are stable in the absence of antibiotic selection. 39R861+ is resistant to nalidixic acid due to a chromosomal mutation. The remaining resistance determinants are plasmid-borne. 39R861+ contains six plasmids, outlined in the supplemental files.

Proper citation: RRID:Addgene_119737 Copy   


  • RRID:Addgene_134836

http://www.addgene.org/134836

Genetic Insert: lysogen of a temperature-inducible bacteriophage lambda
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:28522818
Comments: Genotype is [λ+ Lac- galK2 IN(rrnD-rrnE)1 rph-1], a derivative of strain W3102 Phenotypic assay: Grow at 30°C, but restricted at 42°C due to the induction of phage particles and cell lysis.

Proper citation: RRID:Addgene_134836 Copy   


  • RRID:Addgene_141407

http://www.addgene.org/141407

Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:31980824
Comments: λ- F- glnX44 e14- (McrA-) rfbD1 endA1 thi-1 Δ(yjiT-opgB)114::IS10 (EcoKI R- M- McrBC- Mrr-) + rpoS393(am) creC510 lrhA::IS3 ydeN::IS10 ΔlacI Verification of lacI deletion: PCR reaction on genomic DNA using AK362 and AK365 primers produces a 1936 bp fragment AK 362 5’-CAATACCAATCGCACGCGG AK 365 5’-CGAGACGTCACGGAAAATGCC Phenotype: Constitutive β-galactosidase synthesis This strain was derived from the precursor strain, E. coli ER1821, which is described in Jobling et al. (2016) Complete Genome Sequence of Escherichia coli ER1821R, a Laboratory K-12 Derivative Engineered To Be Deficient in All Methylcytosine and Methyladenine Restriction Systems. Genome Announc 4(4):e00763-16. https://www.ncbi.nlm.nih.gov/pubmed/27516504

Proper citation: RRID:Addgene_141407 Copy   


  • RRID:Addgene_176581

http://www.addgene.org/176581

Genetic Insert: This is a strain.
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc

Proper citation: RRID:Addgene_176581 Copy   


  • RRID:Addgene_34929

    This resource has 1+ mentions.

http://www.addgene.org/34929

Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21868676
Comments: To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain BL21. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy.

Proper citation: RRID:Addgene_34929 Copy   


  • RRID:Addgene_35609

    This resource has 1+ mentions.

http://www.addgene.org/35609

Genetic Insert: none
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:10610690
Comments: To be used with the following plasmids from the Matthews lab: pTARA (www.addgene.org/31491), pLS1 (www.addgene.org/31490), and (www.addgene.org/31492) pLS1/-11

Proper citation: RRID:Addgene_35609 Copy   


  • RRID:Addgene_37853

http://www.addgene.org/37853

Vector Backbone Description: Vector Backbone:N/A; Vector Types:E. coli bacterial strain; Bacterial Resistance:None
Defining Citation: PMID:20643967

Proper citation: RRID:Addgene_37853 Copy   


  • RRID:Addgene_37854

    This resource has 1+ mentions.

http://www.addgene.org/37854

Vector Backbone Description: Vector Backbone:N/A; Vector Types:E. coli bacterial strain; Bacterial Resistance:None
Defining Citation: PMID:21110891

Proper citation: RRID:Addgene_37854 Copy   


  • RRID:Addgene_49761

    This resource has 1+ mentions.

http://www.addgene.org/49761

Genetic Insert: Relevant genotype: recA1, endA1, gyrA96, thi, hsdR17, supE44, relA1, λ-, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:2985470

Proper citation: RRID:Addgene_49761 Copy   


  • RRID:Addgene_49759

http://www.addgene.org/49759

Species: E.coli
Genetic Insert: Relevant genotype: endA1, gyrA96, thi, hsdR17, supE44, relA1, λ-, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:2985470

Proper citation: RRID:Addgene_49759 Copy   


  • RRID:Addgene_49757

http://www.addgene.org/49757

Species: E.coli
Genetic Insert: Relevant genotype: endA1, gyrA96, thi, hsdR17, supE44, relA1, λ-, Δ(lac-proAB)
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:2985470

Proper citation: RRID:Addgene_49757 Copy   


  • RRID:Addgene_50349

http://www.addgene.org/50349

Species: E. coli
Genetic Insert: Relevant genotype: supE, thi, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None

Proper citation: RRID:Addgene_50349 Copy   


  • RRID:Addgene_50348

http://www.addgene.org/50348

Species: E. coli
Genetic Insert: Relevant genotype: ara, Δ(lac-proAB), rspL(+strA), ϕ80, lacZΔM15
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None

Proper citation: RRID:Addgene_50348 Copy   


  • RRID:Addgene_52704

http://www.addgene.org/52704

Genetic Insert: KI (37)-Oplac2 strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of Oplac2 with those of KIlac, producing and KI(37)-Oplac2.

Proper citation: RRID:Addgene_52704 Copy   


  • RRID:Addgene_52705

http://www.addgene.org/52705

Genetic Insert: degtag strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: To generate the degtag strain, we introduced the ssrA tag to the C-terminus of LacZ, thus targeting the protein for degradation by the ClpXP and ClpAP proteases.

Proper citation: RRID:Addgene_52705 Copy   


  • RRID:Addgene_52703

http://www.addgene.org/52703

Genetic Insert: KI (37)-Oplac1 strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of OpLac1 with those of KIlac.

Proper citation: RRID:Addgene_52703 Copy   


  • RRID:Addgene_52700

http://www.addgene.org/52700

Genetic Insert: OpLac2-Δ6 strain
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: Oplac2Δ6 was erroneously synthesized missing the first 6 nucleotides of Oplac2. These deletions correspond to the first 2 N-terminal amino acid residues (Methionine and Threonine), and instead begin at the Methionine at position 3.

Proper citation: RRID:Addgene_52700 Copy   


  • RRID:Addgene_52701

http://www.addgene.org/52701

Genetic Insert: Oplac1 (37)-KI strain
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of KILac with those of OpLac1.

Proper citation: RRID:Addgene_52701 Copy   


  • RRID:Addgene_52709

http://www.addgene.org/52709

Genetic Insert: S56L strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: Impaired LacY function

Proper citation: RRID:Addgene_52709 Copy   


  • RRID:Addgene_52706

    This resource has 1+ mentions.

http://www.addgene.org/52706

Genetic Insert: ΔZ strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: lacZ deletion

Proper citation: RRID:Addgene_52706 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X