Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 2 showing 21 ~ 40 out of 1,881 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.addgene.org/46700

Species: Caenorhabditis elegans
Genetic Insert: mir40-5
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46700 Copy   

http://www.addgene.org/46653

Species: Caenorhabditis elegans
Genetic Insert: cel-mir-40
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46653 Copy   

http://www.addgene.org/46651

Species: Caenorhabditis elegans
Genetic Insert: cel-mir-1
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46651 Copy   

http://www.addgene.org/46652

Species: Caenorhabditis elegans
Genetic Insert: cel-mir-34
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46652 Copy   

http://www.addgene.org/46657

Species: Caenorhabditis elegans
Genetic Insert: cel-mir-59
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46657 Copy   

http://www.addgene.org/46650

Species: Caenorhabditis elegans
Genetic Insert: cel-lsy-6
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46650 Copy   

http://www.addgene.org/46648

Species: Caenorhabditis elegans
Genetic Insert: cel-let-7
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46648 Copy   

http://www.addgene.org/46742

Species: Caenorhabditis elegans
Genetic Insert: cel-mir-240
Vector Backbone Description: Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46742 Copy   

http://www.addgene.org/46740

Species: Caenorhabditis elegans
Genetic Insert: cel-mir-50
Vector Backbone Description: Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46740 Copy   

http://www.addgene.org/47542

Species: Caenorhabditis elegans
Genetic Insert: Glutamate-gated chloride channels
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2037; Vector Backbone:pcDNA3.1/V5-His TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23720773

Proper citation: RRID:Addgene_47542 Copy   

http://www.addgene.org/47387

Species: Caenorhabditis elegans
Genetic Insert: glutamate-gated chloride Channels
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5523; Vector Backbone:pcDNA3.1/V5-His TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23720773

Proper citation: RRID:Addgene_47387 Copy   

    • RRID:Addgene_58982

http://www.addgene.org/58982

Species: Caenorhabditis elegans
Genetic Insert: avr-15 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GTTTGCAATATAAGTCACCC

Proper citation: RRID:Addgene_58982 Copy   

    • RRID:Addgene_58981

http://www.addgene.org/58981

Species: Caenorhabditis elegans
Genetic Insert: avr-14 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GATTGGAGAGTTAGACCACG

Proper citation: RRID:Addgene_58981 Copy   

    • RRID:Addgene_59181

http://www.addgene.org/59181

Species: Caenorhabditis elegans
Genetic Insert: Blasticidin S resistance
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:1961; Vector Backbone:pBluescript KS(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24879462

Proper citation: RRID:Addgene_59181 Copy   

    • RRID:Addgene_59555

http://www.addgene.org/59555

Species: Caenorhabditis elegans
Genetic Insert: 1-209
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958

Proper citation: RRID:Addgene_59555 Copy   

    • RRID:Addgene_59550

http://www.addgene.org/59550

Species: Caenorhabditis elegans
Genetic Insert: 1-214
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958

Proper citation: RRID:Addgene_59550 Copy   

    • RRID:Addgene_59553

http://www.addgene.org/59553

Species: Caenorhabditis elegans
Genetic Insert: 1-211
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958

Proper citation: RRID:Addgene_59553 Copy   

    • RRID:Addgene_59786

    This resource has 1+ mentions.

http://www.addgene.org/59786

Species: Caenorhabditis elegans
Genetic Insert: cdc-42 promoter
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25377555

Proper citation: RRID:Addgene_59786 Copy   

    • RRID:Addgene_59784

http://www.addgene.org/59784

Species: Caenorhabditis elegans
Genetic Insert: elt-2 promoter
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25377555

Proper citation: RRID:Addgene_59784 Copy   

    • RRID:Addgene_59932

http://www.addgene.org/59932

Species: Caenorhabditis elegans
Genetic Insert: unc-109(n499) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25161212

Proper citation: RRID:Addgene_59932 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch