Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

4,486 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pMGAHisTev5B
 
Resource Report
Resource Website
RRID:Addgene_37221 eIF5B Saccharomyces cerevisiae Kanamycin PMID:17913637 Vector Backbone:pSKB3; Vector Types:; Bacterial Resistance:Kanamycin N-term truncation (contains aa 396-1002) 2026-08-15 01:14:13 0
pUC19-HHtRNA
 
Resource Report
Resource Website
RRID:Addgene_37222 HHtRNA Saccharomyces cerevisiae Ampicillin PMID:17913637 HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pTYB2-eIF1
 
Resource Report
Resource Website
RRID:Addgene_37217 eIF1 Saccharomyces cerevisiae Ampicillin PMID:17913637 Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pTYB2-eIF5
 
Resource Report
Resource Website
RRID:Addgene_37219 eIF5 Saccharomyces cerevisiae Ampicillin PMID:17913637 Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pTYB2-HCR1
 
Resource Report
Resource Website
RRID:Addgene_37233 HRC1 Saccharomyces cerevisiae Ampicillin PMID:20864040 Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pGST1-yHse1-UIM
 
Resource Report
Resource Website
RRID:Addgene_44429 yHse1-UIM (150-190) Saccharomyces cerevisiae Ampicillin PMID:20150893 Backbone Size:5000; Vector Backbone:pGST-parallel.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:15 0
pGST1-yVps27-VHS
 
Resource Report
Resource Website
RRID:Addgene_44417 Vps27-VHS (2-150) Saccharomyces cerevisiae Ampicillin PMID:20150893 Backbone Size:5000; Vector Backbone:pGST1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:15 0
pDN-G1TCbt
 
Resource Report
Resource Website
RRID:Addgene_44515 PGal1-D12 promoter Saccharomyces cerevisiae Ampicillin PMID:19279212 Backbone Marker:Stratagene; Backbone Size:4274; Vector Backbone:pRS404; Vector Types:Yeast Expression, Synthetic Biology, Expression regulator/reporter; Bacterial Resistance:Ampicillin Two tandem tet operators (2XtetO2) downstream of the GAL1 TATA box 2026-08-15 01:15:15 0
pDN-T1TCbt
 
Resource Report
Resource Website
RRID:Addgene_44514 PGal1-T123 promoter Saccharomyces cerevisiae Ampicillin PMID:19279212 Backbone Marker:Stratagene; Backbone Size:4274; Vector Backbone:pRS404; Vector Types:Yeast Expression, Synthetic Biology, Expression regulator/reporter; Bacterial Resistance:Ampicillin Three tandem tet operators (3XtetO2) downstream of the GAL1 TATA box 2026-08-15 01:15:15 0
pDN-G1GZmbh
 
Resource Report
Resource Website
RRID:Addgene_44516 PGal1-D12 promoter Saccharomyces cerevisiae Ampicillin PMID:19279212 Backbone Marker:Stratagene; Backbone Size:4456; Vector Backbone:pRS403; Vector Types:Yeast Expression, Synthetic Biology, Expression regulator/reporter; Bacterial Resistance:Ampicillin Two tandem tet operators (2XtetO2) downstream of the GAL1 TATA box 2026-08-15 01:15:16 0
pDN-G1TGt
 
Resource Report
Resource Website
RRID:Addgene_44508 PGal1-D12 promoter Saccharomyces cerevisiae Ampicillin PMID:19279212 Backbone Marker:Stratagene; Backbone Size:4274; Vector Backbone:pRS404; Vector Types:Yeast Expression, Synthetic Biology, Expression regulator/reporter; Bacterial Resistance:Ampicillin Two tandem tet operators (2XtetO2) downstream of the GAL1 TATA box 2026-08-15 01:15:15 0
pCM350
 
Resource Report
Resource Website
RRID:Addgene_44549 HA-htz1 Saccharomyces cerevisiae Ampicillin PMID:16543223 Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-22 2026-08-15 01:15:16 0
pFX21
 
Resource Report
Resource Website
RRID:Addgene_44533 SIR2-6xHis Saccharomyces cerevisiae Kanamycin PMID:17889663 Vector Backbone:pET-24a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:16 0
pUK499
 
Resource Report
Resource Website
RRID:Addgene_44535 HHF2 Saccharomyces cerevisiae Ampicillin PMID:3046933 Vector Backbone:pTSB1-1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:16 0
pUK421
 
Resource Report
Resource Website
RRID:Addgene_44534 GAL1-HHF2 Saccharomyces cerevisiae Ampicillin PMID:3046933 Vector Backbone:pTSB1-1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:16 0
pRM415
 
Resource Report
Resource Website
RRID:Addgene_44526 HHT2 Saccharomyces cerevisiae Ampicillin PMID:1505519 Vector Backbone:pLJ999T; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin hht2 deletion 4-15 2026-08-15 01:15:16 0
pRM102
 
Resource Report
Resource Website
RRID:Addgene_44525 P(GAL10)-HHT2 P(GAL1)-HHF2 Saccharomyces cerevisiae Ampicillin PMID:1505519 Vector Backbone:pUK420; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:16 0
pRM204
 
Resource Report
Resource Website
RRID:Addgene_44528 HHF2-HHT2 Saccharomyces cerevisiae Ampicillin PMID:1505519 Vector Backbone:pRS314-B; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:16 0
pRM214
 
Resource Report
Resource Website
RRID:Addgene_44527 HHT2 Saccharomyces cerevisiae Ampicillin PMID:1505519 Vector Backbone:pLJ999T; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin K14R 2026-08-15 01:15:16 0
pRM200U
 
Resource Report
Resource Website
RRID:Addgene_44529 HHF2-HHT2 Saccharomyces cerevisiae Ampicillin PMID:1505519 Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:16 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.