Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 2 showing 21 ~ 40 out of 30,397 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_51428

http://www.addgene.org/51428

Species: Synthetic
Genetic Insert: SeqFosC
Vector Backbone Description: Backbone Size:7372; Vector Backbone:pAF1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24981864

Proper citation: RRID:Addgene_51428 Copy   


  • RRID:Addgene_51430

http://www.addgene.org/51430

Species: Synthetic
Genetic Insert: SeqFosA
Vector Backbone Description: Backbone Size:7485; Vector Backbone:pAF1-VP64; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24981864

Proper citation: RRID:Addgene_51430 Copy   


  • RRID:Addgene_51432

http://www.addgene.org/51432

Species: Synthetic
Genetic Insert: SeqFosC
Vector Backbone Description: Backbone Size:7705; Vector Backbone:pAF1-VP16; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24981864

Proper citation: RRID:Addgene_51432 Copy   


http://www.addgene.org/51439

Species: Synthetic
Genetic Insert: TALEN CCR5 Right (R18) Can C-term
Vector Backbone Description: Backbone Marker:Joung lab; Backbone Size:5055; Vector Backbone:JDS70; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24531420

Proper citation: RRID:Addgene_51439 Copy   


http://www.addgene.org/51441

Species: Synthetic
Genetic Insert: TALEN CCR5 Right (R18) Q3 C-term
Vector Backbone Description: Backbone Marker:Joung lab; Backbone Size:5055; Vector Backbone:JDS70; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24531420

Proper citation: RRID:Addgene_51441 Copy   


http://www.addgene.org/51440

Species: Synthetic
Genetic Insert: TALEN CCR5 Left (L18) Q3 C-term
Vector Backbone Description: Backbone Marker:Joung lab; Backbone Size:5055; Vector Backbone:JDS70; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24531420

Proper citation: RRID:Addgene_51440 Copy   


http://www.addgene.org/51449

Species: Synthetic
Genetic Insert: TALEN CCR5 Right (R18) N3 N-term
Vector Backbone Description: Backbone Marker:Joung lab; Backbone Size:5055; Vector Backbone:JDS70; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24531420

Proper citation: RRID:Addgene_51449 Copy   


http://www.addgene.org/51448

Species: Synthetic
Genetic Insert: TALEN CCR5 Left (L18) N3 N-term
Vector Backbone Description: Backbone Marker:Joung lab; Backbone Size:5055; Vector Backbone:JDS70; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24531420

Proper citation: RRID:Addgene_51448 Copy   


http://www.addgene.org/51446

Species: Synthetic
Genetic Insert: TALEN CCR5 Left (L18) N1 N-term
Vector Backbone Description: Backbone Marker:Joung lab; Backbone Size:5055; Vector Backbone:JDS70; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24531420

Proper citation: RRID:Addgene_51446 Copy   


  • RRID:Addgene_51468

http://www.addgene.org/51468

Species: Synthetic
Genetic Insert: Replacing the cpc operon with kanamycin resistance
Vector Backbone Description: Backbone Marker:DNA2.0; Backbone Size:4835; Vector Backbone:pJ207; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25046143
Comments: Formighieri C, Melis A (2015) A phycocyanin·phellandrene synthase fusion enhances recombinant protein expression and β-phellandrene (monoterpene) hydrocarbons production in Synechocystis (cyanobacteria). Metab Eng 32:116–124. http://dx.doi.org/10.1016/j.ymben.2015.09.010

Proper citation: RRID:Addgene_51468 Copy   


http://www.addgene.org/51656

Species: Synthetic
Genetic Insert: Quasar2-mOrange-Chr64-GFP
Vector Backbone Description: Vector Backbone:lentivirus backbone; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_51656 Copy   


  • RRID:Addgene_51559

    This resource has 1+ mentions.

http://www.addgene.org/51559

Species: Synthetic
Genetic Insert: superfolder GFP
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23893733
Comments: The sfGFP in this plasmid contains Y148C and K214I mutations that do not affect the function of the plasmid.

Proper citation: RRID:Addgene_51559 Copy   


  • RRID:Addgene_51562

http://www.addgene.org/51562

Species: Synthetic
Genetic Insert: superfolder GFP
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pTXB1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_51562 Copy   


  • RRID:Addgene_51638

    This resource has 1+ mentions.

http://www.addgene.org/51638

Species: Synthetic
Genetic Insert: Codon-optimized Cas9 D10A
Vector Backbone Description: Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24491566
Comments: This plasmid vector was constructed by mutation PCR of pCAG-T3-hCAS9-pA plasmid vector (Addgene plasmid 48625) using the primers (Forward primer, 5’-AGTACTCCATTGGGCTCGccATCGGCACAAAC, and Reverse primer, 5’-CGAGCCCAATGGAGTACTTCTTGTCGGCTGC). For the in vitro synthesis of CAS9 D10A mRNAs, the vector was linearized by SphI and in-vitro transcribed using T3-RNA-polymerase (Promega) in the presence of m7G(5′)ppp(5′)G to synthesize capped RNA. The Tbpl1 3′UTR 95 nucleotide polyA tail at the 3' end of the insert allows in vitro transcribed mRNA from this plasmid to be used directly for microinjection into animal embryos or oocytes without additional polyadenylation treatment. The CAG promoter in this plasmid also allows it to be used as a CAS9-expression vector.

Proper citation: RRID:Addgene_51638 Copy   


  • RRID:Addgene_51790

http://www.addgene.org/51790

Species: Synthetic
Genetic Insert: EBFP2
Vector Backbone Description: Vector Backbone:pZDONOR 5-6; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25369267

Proper citation: RRID:Addgene_51790 Copy   


http://www.addgene.org/51686

Species: Synthetic
Genetic Insert: aDTX-lumitoxin
Vector Backbone Description: Backbone Size:5341; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24407101

Proper citation: RRID:Addgene_51686 Copy   


  • RRID:Addgene_51722

    This resource has 1+ mentions.

http://www.addgene.org/51722

Species: Synthetic
Genetic Insert: SpyLigase
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:6400; Vector Backbone:pDEST14; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24639550
Comments: SnoopLigase is the more recent peptide-peptide ligation technology from the Howarth lab and is now preferred over SpyLigase in terms of more general reaction conditions and higher coupling yield on a range of proteins. pET28a-AviTag-SnoopLigase https://www.addgene.org/105626/ pET28a-HaloTag7-SnoopLigase https://www.addgene.org/105627/ SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture. Jacob O. Fierer, Gianluca Veggiani and Mark Howarth Transform plasmid into BL21 DE3 RIPL for expression.

Proper citation: RRID:Addgene_51722 Copy   


  • RRID:Addgene_51694

    This resource has 1+ mentions.

http://www.addgene.org/51694

Species: Synthetic
Genetic Insert: Optopatch2
Vector Backbone Description: Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24952910

Proper citation: RRID:Addgene_51694 Copy   


  • RRID:Addgene_51695

    This resource has 1+ mentions.

http://www.addgene.org/51695

Species: Synthetic
Genetic Insert: Optopatch1
Vector Backbone Description: Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24952910

Proper citation: RRID:Addgene_51695 Copy   


  • RRID:Addgene_51762

    This resource has 1+ mentions.

http://www.addgene.org/51762

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336571
Comments: gRNA target sequence GGCCACAAGTTCAGCGTGTC These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids. Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.

Proper citation: RRID:Addgene_51762 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X