Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: protein A - hia5
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35396487
Comments: The depositing laboratory recommends Addgene Plasmid 222303: prhaBAD-pA-Hia5, an improved version of this plasmid.
Protocol for purification and expression can be found at: dx.doi.org/10.17504/protocols.io.bv82n9ye
Application for DiMeLo-seq is described in: doi.org/10.1101/2021.07.06.451383
Protocol was adapted and modified from: doi.org/10.1126/science.aaz1646
Proper citation: RRID:Addgene_174372 Copy
Species: Other
Genetic Insert: Venus with golgi apparatus-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740
Proper citation: RRID:Addgene_174472 Copy
Species: Other
Genetic Insert: Sirius with actin-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740
Proper citation: RRID:Addgene_174475 Copy
Species: Other
Genetic Insert: EGFP with actin-targeting sequence
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31735740
Proper citation: RRID:Addgene_174477 Copy
Species: Other
Genetic Insert: EGFP-Synaptobrevin-2; tdTomato
Vector Backbone Description: Backbone Size:4561; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Comments: Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab:
5': actcagcgctgcctcagtc (upstream of tdTomato)
3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato)
5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato)
3': gctgaacttgtggccgtttacgtcg (in EGFP)
3': cagggtcagcttgccgtaggtggcatcg (in EGFP)
Proper citation: RRID:Addgene_175275 Copy
Species: Other
Genetic Insert: GaLV MTR envelope
Vector Backbone Description: Backbone Marker:Addgene 15802; Backbone Size:4764; Vector Backbone:phCMV-ECO-ENV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31586074
Comments: This plasmid was generated by modification of Addgene plasmid 15802 to excise ENV-Eco and replace with ENV GALV-MTR.
Proper citation: RRID:Addgene_163612 Copy
Species: Other
Genetic Insert: GPI anchored TurboID
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33177716
Proper citation: RRID:Addgene_163697 Copy
Species: Other
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pCsA; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32163700
Proper citation: RRID:Addgene_163949 Copy
Species: Other
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pCk1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32163700
Proper citation: RRID:Addgene_163942 Copy
Species: Other
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pCk1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32163700
Proper citation: RRID:Addgene_163943 Copy
Species: Other
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pCsA; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32163700
Proper citation: RRID:Addgene_163946 Copy
Species: Other
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pCk1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32163700
Proper citation: RRID:Addgene_163945 Copy
Species: Other
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pCsA; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32163700
Proper citation: RRID:Addgene_163948 Copy
Species: Other
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pCsA; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32163700
Proper citation: RRID:Addgene_163947 Copy
Species: Other
Genetic Insert: Marchantia polymorpha rbcL_trnR region homologous sequence
Vector Backbone Description: Vector Backbone:pCk1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32163700
Proper citation: RRID:Addgene_163938 Copy
Species: Other
Genetic Insert: Marchantia polymorpha petB 5'UTR
Vector Backbone Description: Vector Backbone:pUAP4; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34097383
Proper citation: RRID:Addgene_163933 Copy
Species: Other
Genetic Insert: Nicotiana tabacum psba terminator
Vector Backbone Description: Vector Backbone:pUAP4; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:32163700
Proper citation: RRID:Addgene_163932 Copy
Species: Other
Genetic Insert: aadA gene for spectinomycin resistance
Vector Backbone Description: Vector Backbone:pUAP4; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:32163700
Proper citation: RRID:Addgene_163935 Copy
Species: Other
Genetic Insert: Marchantia polymorpha chloroplast DNA-dependent RNA polymerase operon promoter (rpo) (genome position: 5595-5739)
Vector Backbone Description: Vector Backbone:pUAP4; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:32163700
Proper citation: RRID:Addgene_163951 Copy
Species: Other
Genetic Insert: Nicotiana tabacum psbA promoter
Vector Backbone Description: Vector Backbone:pUAP4; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34097383
Proper citation: RRID:Addgene_163950 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
