Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: syt7 C2A-2A 2B
Vector Backbone Description: Vector Backbone:pET SUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38012142
Proper citation: RRID:Addgene_213626 Copy
Species: Mus musculus
Genetic Insert: STING
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34290407
Proper citation: RRID:Addgene_214157 Copy
Species: Mus musculus
Genetic Insert: STING (N153S)
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26235147
Proper citation: RRID:Addgene_214158 Copy
Species: Mus musculus
Genetic Insert: GCC2
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36379959
Proper citation: RRID:Addgene_214166 Copy
Species: Mus musculus
Genetic Insert: FL-syt7
Vector Backbone Description: Vector Backbone:pET SUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38012142
Proper citation: RRID:Addgene_213630 Copy
Species: Mus musculus
Genetic Insert: anti-MOG (Rattus norvegicus) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30667360
Comments: This is a recombinant antibody derived from RRID: AB_2895697. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_190296 Copy
Species: Mus musculus
Genetic Insert: SYT7
Vector Backbone Description: Vector Backbone:PFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34543184
Proper citation: RRID:Addgene_179717 Copy
Species: Mus musculus
Genetic Insert: STING
Vector Backbone Description: Vector Backbone:pMRX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34290407
Proper citation: RRID:Addgene_214148 Copy
Species: Mus musculus
Genetic Insert: Cry2 - mCherry - Profilin.WT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4018; Vector Backbone:mCherry N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38457348
Comments: Please visit https://doi.org/10.1101/2023.10.04.560945 for bioRxiv preprint.
Proper citation: RRID:Addgene_208286 Copy
Species: Mus musculus
Genetic Insert: U6-3xsgRNA-Crym
Vector Backbone Description: Backbone Marker:Khakh lab; Backbone Size:3472; Vector Backbone:PZac2.1; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38418885
Proper citation: RRID:Addgene_200067 Copy
Species: Mus musculus
Genetic Insert: GfaABC1D-Crym-BioID2-BioID2
Vector Backbone Description: Backbone Size:3037; Vector Backbone:PZac2.1; Vector Types:Mouse Targeting, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38418885
Proper citation: RRID:Addgene_200070 Copy
Species: Mus musculus
Genetic Insert: EEA1
Vector Backbone Description: Vector Backbone:pUC-GW-Amp; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Comments: Target site is: CCGGCCAAACCATGTTTCGAAGG (AGG is the PAM). Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_214990 Copy
Species: Mus musculus
Genetic Insert: BMP reporter element and miniXon casette
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_217534 Copy
Species: Mus musculus
Genetic Insert: 2xHP1bCD_W42A-IFP2.0C
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38554702
Proper citation: RRID:Addgene_215751 Copy
Species: Mus musculus
Genetic Insert: 4X BRE reporter and miniXon casette
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_217535 Copy
Species: Mus musculus
Genetic Insert: ZnF-FingR-PSD95-mGreenLantern
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_217533 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5086; Vector Backbone:pBabePuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36069770
Proper citation: RRID:Addgene_206865 Copy
Species: Mus musculus
Genetic Insert: TMEM115
Vector Backbone Description: Vector Backbone:pLV UBC; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_214997 Copy
Species: Mus musculus
Genetic Insert: Shtn1 long isoform with E16-17 deletion
Vector Backbone Description: Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30733148
Proper citation: RRID:Addgene_209564 Copy
Species: Mus musculus
Genetic Insert: Clip2
Vector Backbone Description: Vector Backbone:pFlare9A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30733148
Proper citation: RRID:Addgene_209575 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
