Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: HIV-1
Genetic Insert: HIV-1 Gag/Pol, Tat, Rev
Vector Backbone Description: Backbone Size:2246; Vector Backbone:pcDNA3.1 (Invitrogen); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14722277
Proper citation: RRID:Addgene_17531 Copy
Genetic Insert: Puromycine Acetyl Transferase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:0; Vector Backbone:pCoHYGRO; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14513552
Proper citation: RRID:Addgene_17533 Copy
Species: Caenorhabditis elegans
Genetic Insert: DAF-16a
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:6000; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24671950
Proper citation: RRID:Addgene_175283 Copy
Species: Synthetic
Genetic Insert: Reverse tetracycline-controlled transactivator (rtTA)
Vector Backbone Description: Backbone Size:3951; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Proper citation: RRID:Addgene_175274 Copy
Species: Other
Genetic Insert: EGFP-Synaptobrevin-2; tdTomato
Vector Backbone Description: Backbone Size:4561; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Comments: Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab:
5': actcagcgctgcctcagtc (upstream of tdTomato)
3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato)
5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato)
3': gctgaacttgtggccgtttacgtcg (in EGFP)
3': cagggtcagcttgccgtaggtggcatcg (in EGFP)
Proper citation: RRID:Addgene_175275 Copy
Species: Yellow fever virus strain 17D
Genetic Insert: Nonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato
Vector Backbone Description: Backbone Size:4591; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Proper citation: RRID:Addgene_175276 Copy
Species: Yellow fever virus strain 17D
Genetic Insert: NS1
Vector Backbone Description: Backbone Size:3901; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Proper citation: RRID:Addgene_175279 Copy
Vector Backbone Description: Vector Backbone:PiggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35474898
Comments: Selectable marker is flanked by Rox sites for excision with Dre recombinase.
Proper citation: RRID:Addgene_175271 Copy
Species: Yellow fever virus strain 17D
Genetic Insert: Nonstructural protein 1 (NS1) of YFV-17D
Vector Backbone Description: Backbone Size:4470; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Proper citation: RRID:Addgene_175273 Copy
Species: Homo sapiens
Genetic Insert: ENO1
Vector Backbone Description: Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin
Comments: Please note in Addgene's NGS result identified a single ambiguous base in the insert adjacent to the TEV site. This base is a mixed population of A (48.4%) and G (51.2%). If it is an A the amino acid changes from G to E. Depositor confirmed this mutation does not affect plasmid function. Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint.
Proper citation: RRID:Addgene_175330 Copy
Species: Mus musculus
Genetic Insert: Z-lock αTAT
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pTriEx4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31740825
Proper citation: RRID:Addgene_175290 Copy
Vector Backbone Description: Backbone Marker:ExpreS2ion Biotechnologies; Backbone Size:2864; Vector Backbone:pExpreS2-1; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35600892
Comments: This plasmid is designed for use with the ExpreS2 Platform from ExpreS2ion Biotechnologies. It is intended to be used with the ExpreS2ion cells and media which can be obtained directly from the ExpreS2ion website.
Proper citation: RRID:Addgene_175362 Copy
Species: Mus musculus
Genetic Insert: anti-FLAG M2 light chain
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34121409
Proper citation: RRID:Addgene_175358 Copy
Species: Synthetic
Genetic Insert: GFP-Cre recombinase
Vector Backbone Description: Backbone Size:4561; Vector Backbone:pAAV hSyn; Vector Types:AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_175381 Copy
Species: Synthetic
Genetic Insert: TVA-P2A-eGFP-P2A-N2cG
Vector Backbone Description: Backbone Marker:Jordane Dimidschstein (Addgene plasmid # 170853); Vector Backbone:pAAV-VTKS2; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34758329
Proper citation: RRID:Addgene_175439 Copy
Species: Homo sapiens
Genetic Insert: B-Raf
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17699719
Proper citation: RRID:Addgene_17544 Copy
Species: Homo sapiens
Genetic Insert: H2B-HaloTag10 and Tomm20-HaloTag9
Vector Backbone Description: Vector Backbone:pCDNA5/FR/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34916672
Comments: Please note there are an additional 35 amino acids at the end of the insert. Depositor confirms these do not affect plasmid function. This plasmid was used in the experiments discussed in their publication.
Proper citation: RRID:Addgene_175525 Copy
Species: CoV2
Genetic Insert: nsp1 CoV2
Vector Backbone Description: Backbone Marker:GE (cytiva); Backbone Size:4950; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34624207
Proper citation: RRID:Addgene_175512 Copy
Species: Mus musculus
Genetic Insert: Pomc promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16604086
Comments: Addgene's sequence shows a C->T mutation in nt 129 of POMC. The depositing scientist is aware of this mutation and has found that it does not alter the promoter activity.
Proper citation: RRID:Addgene_17553 Copy
Species: Mus musculus
Genetic Insert: Foxo1-WT-DBD
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pDNR-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17717603
Comments: This plasmid also contains a E226G mutation--the author has determined that this mutation does not affect the plasmid detrimentally. It also has K219R and L619P polymorphisms.
Proper citation: RRID:Addgene_17555 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
