Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 203 showing 4041 ~ 4060 out of 12,959 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_105005

    This resource has 1+ mentions.

http://www.addgene.org/105005

Species: Mus musculus
Genetic Insert: PDZD8
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29097544

Proper citation: RRID:Addgene_105005 Copy   

http://www.addgene.org/105006

Species: Mus musculus
Genetic Insert: PDZD8
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29097544

Proper citation: RRID:Addgene_105006 Copy   

http://www.addgene.org/105035

Species: Mus musculus
Genetic Insert: Pou5f1
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108

Proper citation: RRID:Addgene_105035 Copy   

http://www.addgene.org/105034

Species: Mus musculus
Genetic Insert: Ptpn23
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108

Proper citation: RRID:Addgene_105034 Copy   

http://www.addgene.org/105031

Species: Mus musculus
Genetic Insert: Ndufa2
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108

Proper citation: RRID:Addgene_105031 Copy   

http://www.addgene.org/105032

Species: Mus musculus
Genetic Insert: gRNA targeting Hgs
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108

Proper citation: RRID:Addgene_105032 Copy   

http://www.addgene.org/105073

Species: Mus musculus
Genetic Insert: Drd1a->M71-IRES-tauGFP-ACNF
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBlueScript II SK; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29407371
Comments: References: -Feinstein, P., Bozza, T., Rodriguez, I., Vassalli, A., Mombaerts, P., 2004. Axon guidance of mouse olfactory sensory neurons by odorant receptors and the β2 adrenergic receptor. Cell 117, 833–846. -Omura, M., Grosmaitre, X., Ma, M., Mombaerts, P., 2014. The β2-adrenergic receptor as a surrogate odorant receptor in mouse olfactory sensory neurons. Mol. Cell. Neurosci. 58, 1-10.

Proper citation: RRID:Addgene_105073 Copy   

http://www.addgene.org/105040

Species: Mus musculus
Genetic Insert: Tsc2
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108

Proper citation: RRID:Addgene_105040 Copy   

http://www.addgene.org/105041

Species: Mus musculus
Genetic Insert: Rictor
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108

Proper citation: RRID:Addgene_105041 Copy   

http://www.addgene.org/105037

Species: Mus musculus
Genetic Insert: Nprl2
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108

Proper citation: RRID:Addgene_105037 Copy   

http://www.addgene.org/105038

Species: Mus musculus
Genetic Insert: Nprl2
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108

Proper citation: RRID:Addgene_105038 Copy   

http://www.addgene.org/105036

Species: Mus musculus
Genetic Insert: Pou5f1
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108

Proper citation: RRID:Addgene_105036 Copy   

http://www.addgene.org/105042

Species: Mus musculus
Genetic Insert: Rictor
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108

Proper citation: RRID:Addgene_105042 Copy   

http://www.addgene.org/105043

Species: Mus musculus
Genetic Insert: Stk11
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108

Proper citation: RRID:Addgene_105043 Copy   

    • RRID:Addgene_112733

http://www.addgene.org/112733

Species: Mus musculus
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Feng Zhang; Backbone Size:4574; Vector Backbone:PX552; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29706865
Comments: gRNA targeting mouse Gsk3b gene was cloned into the plasmid PX552 received from Dr. Feng Zhang.

Proper citation: RRID:Addgene_112733 Copy   

    • RRID:Addgene_112711

    This resource has 1+ mentions.

http://www.addgene.org/112711

Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5078; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: For more information about this plasmid, see Mukherjee et al. 2014 PLoS Biol (10.1371/journal.pbio.1001933). The insert sequence of this plasmid was subcloned from pcDNA3-bio-myc-NES-mCEΔNLS described in this publication. Additional internal sequencing primers: IntCE1-F: GAATGCCCCACCACTGAGAATACTG IntCE2-F: GTTAGGAGAGGTGCAGCAGAAATGTC IntCE3-F: CAAAGAAGTCAGCCATGAAATGGATGGAC

Proper citation: RRID:Addgene_112711 Copy   

    • RRID:Addgene_112716

    This resource has 1+ mentions.

http://www.addgene.org/112716

Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: This plasmid encodes the guanylyltransferase domain of RNGTT.

Proper citation: RRID:Addgene_112716 Copy   

    • RRID:Addgene_112715

    This resource has 1+ mentions.

http://www.addgene.org/112715

Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: This plasmid encodes the triphosphatase domain of RNGTT.

Proper citation: RRID:Addgene_112715 Copy   

    • RRID:Addgene_112704

http://www.addgene.org/112704

Species: Mus musculus
Genetic Insert: Nuclear Factor I X2
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_112704 Copy   

http://www.addgene.org/112841

Species: Mus musculus
Genetic Insert: Catulin-alpha-1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26769899

Proper citation: RRID:Addgene_112841 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch