Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: PDZD8
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29097544
Proper citation: RRID:Addgene_105005 Copy
Species: Mus musculus
Genetic Insert: PDZD8
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29097544
Proper citation: RRID:Addgene_105006 Copy
Species: Mus musculus
Genetic Insert: Pou5f1
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108
Proper citation: RRID:Addgene_105035 Copy
Species: Mus musculus
Genetic Insert: Ptpn23
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108
Proper citation: RRID:Addgene_105034 Copy
Species: Mus musculus
Genetic Insert: Ndufa2
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108
Proper citation: RRID:Addgene_105031 Copy
Species: Mus musculus
Genetic Insert: gRNA targeting Hgs
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108
Proper citation: RRID:Addgene_105032 Copy
Species: Mus musculus
Genetic Insert: Drd1a->M71-IRES-tauGFP-ACNF
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBlueScript II SK; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29407371
Comments: References:
-Feinstein, P., Bozza, T., Rodriguez, I., Vassalli, A., Mombaerts, P., 2004. Axon guidance of mouse olfactory sensory neurons by odorant receptors and the β2 adrenergic receptor. Cell 117, 833–846.
-Omura, M., Grosmaitre, X., Ma, M., Mombaerts, P., 2014. The β2-adrenergic receptor as a surrogate odorant receptor in mouse olfactory sensory neurons. Mol. Cell. Neurosci. 58, 1-10.
Proper citation: RRID:Addgene_105073 Copy
Species: Mus musculus
Genetic Insert: Tsc2
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108
Proper citation: RRID:Addgene_105040 Copy
Species: Mus musculus
Genetic Insert: Rictor
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108
Proper citation: RRID:Addgene_105041 Copy
Species: Mus musculus
Genetic Insert: Nprl2
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108
Proper citation: RRID:Addgene_105037 Copy
Species: Mus musculus
Genetic Insert: Nprl2
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108
Proper citation: RRID:Addgene_105038 Copy
Species: Mus musculus
Genetic Insert: Pou5f1
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108
Proper citation: RRID:Addgene_105036 Copy
Species: Mus musculus
Genetic Insert: Rictor
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108
Proper citation: RRID:Addgene_105042 Copy
Species: Mus musculus
Genetic Insert: Stk11
Vector Backbone Description: Backbone Marker:Yusa Lab; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29996108
Proper citation: RRID:Addgene_105043 Copy
Species: Mus musculus
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Feng Zhang; Backbone Size:4574; Vector Backbone:PX552; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29706865
Comments: gRNA targeting mouse Gsk3b gene was cloned into the plasmid PX552 received from Dr. Feng Zhang.
Proper citation: RRID:Addgene_112733 Copy
Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5078; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: For more information about this plasmid, see Mukherjee et al. 2014 PLoS Biol (10.1371/journal.pbio.1001933). The insert sequence of this plasmid was subcloned from pcDNA3-bio-myc-NES-mCEΔNLS described in this publication.
Additional internal sequencing primers:
IntCE1-F: GAATGCCCCACCACTGAGAATACTG
IntCE2-F: GTTAGGAGAGGTGCAGCAGAAATGTC
IntCE3-F: CAAAGAAGTCAGCCATGAAATGGATGGAC
Proper citation: RRID:Addgene_112711 Copy
Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: This plasmid encodes the guanylyltransferase domain of RNGTT.
Proper citation: RRID:Addgene_112716 Copy
Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: This plasmid encodes the triphosphatase domain of RNGTT.
Proper citation: RRID:Addgene_112715 Copy
Species: Mus musculus
Genetic Insert: Nuclear Factor I X2
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_112704 Copy
Species: Mus musculus
Genetic Insert: Catulin-alpha-1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26769899
Proper citation: RRID:Addgene_112841 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.