Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Authority:addgene (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

177,820 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pFRT/TO/HIS/FLAG/HA-HNRNPD
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_38066 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) Homo sapiens Ampicillin PMID:22681889 Backbone Size:5496; Vector Backbone:pFRT/TO/HIS/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 4
MSCV-N BILF1
 
Resource Report
Resource Website
RRID:Addgene_37938 BILF1 H. Herpesvirus 4 (EBV) Ampicillin PMID:22810586 Note that the Gateway cloning reaction has left several vector-based nucleotides in frame with the 3' end of the insert, leaving additional amino acid residues [PTFLYKVVR] fused to the C-terminus of translated protein. Backbone Size:8162; Vector Backbone:MSCV-N FLAGHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:18 0
pXCX.CMV.tTA.WPRE
 
Resource Report
Resource Website
RRID:Addgene_38057 tTA Ampicillin PMID:15580589 Adenoviral plasmid for overexpression of tet transactivator (tTA) from CMV promoter with WPRE. Additional reference information for this plasmid can be found at: https://www.ncbi.nlm.nih.gov/pubmed/15542617 Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 0
pXCX.Syn.tTA.WPRE
 
Resource Report
Resource Website
RRID:Addgene_38059 tTA Ampicillin PMID:15580589 Adenoviral plasmid for overexpression of tet transactivator (tTA) from Synapsin promoter with WPRE. Additional reference information for this plasmid can be found at: https://www.ncbi.nlm.nih.gov/pubmed/15542617 Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 0
pXCX.Syn.EGFP
 
Resource Report
Resource Website
RRID:Addgene_38054 EGFP Ampicillin PMID:11991741 Adenoviral plasmid for overexpression of EGFP from synapsin promoter Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 0
pXCX.TRE.EGFP.WPRE
 
Resource Report
Resource Website
RRID:Addgene_38060 EGFP Ampicillin PMID:15580589 Adenoviral plasmid for overexpression of EGFP from tetracycline responsive element (TRE), intended to be used in conjucntion with one of the plasmids expressing tet transactivator (tTA), such as Addgene plasmid #'s 38056, 38057, 38058 or 38059. Additional reference information for this plasmid can be found at: https://www.ncbi.nlm.nih.gov/pubmed/15542617 Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 0
MSCV-N E1B 19k
 
Resource Report
Resource Website
RRID:Addgene_38047 E1B 19K Human adenovirus 5 Ampicillin PMID:22810586 Note that the Gateway cloning reaction has left several vector-based nucleotides in frame with the 3' end of the insert, adding several amino acid residues [STFLYKVVR] fused to the C-terminus of translated protein. Backbone Size:8162; Vector Backbone:MSCV-N FLAGHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 0
pCA-FLEX
 
Resource Report
Resource Website
RRID:Addgene_38041 Ampicillin PMID:22681690 Backbone Marker:Masatoshi Takeichi; Backbone Size:4839; Vector Backbone:CA-MCS; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 0
pAAV-EF1a-FLEX-TVA-mCherry
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_38044 Avian sarcoma and leukemia virus receptor 950 Synthetic Ampicillin PMID:22681690 Backbone Marker:Stratagene; Backbone Size:5604; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 23
pXCX.CMV.CREB.WPRE
 
Resource Report
Resource Website
RRID:Addgene_38050 CREB Rattus norvegicus Ampicillin PMID:15129168 Adenoviral plasmid for overexpression of CREB from CMV promoter Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 0
Bcr/Abl P190-pLEF
 
Resource Report
Resource Website
RRID:Addgene_38159 BCR/ABL P190 Homo sapiens Ampicillin PMID:18070886 Constructed by Suparna Mishra. Generated in a 3-way ligation consisting of 5' 0.75 kb BamHI/Sal I + 3' 6.3 kb Sal I/EcoRI BCR/ABL fragments into pLEF digested with BamHIxEcoRI. The ABL part of the insert contains the natural TAG and 3' UT sequences. Addgene NGS identified a sequence discrepancy at nucleotide 3168 resulting in a T117M mutation in the ABL-1 sequence, relative to Genbank ID NP_005148.2 and Addgene Plasmid #38158. This is not a known polymorphism and the effect of this, if any, on the protein is not known. Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin T117M in c-ABL1 2026-08-15 01:14:19 0
EYFP-Abr in pCCL-cppt178-MNDU3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_38155 Abr Homo sapiens Ampicillin PMID:17116687 Constructed by Jess Cunnick. Abr was first subcloned into pEYFP-C1 Bgl II x KpnI as a 0.4 kb 5' BamHI/BstEII + 2.2 kb BstEII- KpnI fragment. The EYFP-Abr fusion was isolated as a 5' AgeI- 3' KpnI fragment and inserted into pCCL-cppt178-MNDU3-X3 digested with Xma I x Kpn I. Backbone Marker:Don Kohn [email protected]; Backbone Size:6600; Vector Backbone:pCCL-cppt178-MNDU3; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 1
Abr-pLEF
 
Resource Report
Resource Website
RRID:Addgene_38157 ABR Homo sapiens Ampicillin PMID:18070886 Constructed by Suparna Mishra. Generated in a 3-way ligation consisting of 5' 0.4 kb BamHI/BstEII + 3' 2.2 kb BstEII/EcoRI ABR fragments into pLEF digested with BamHIxEcoRI. The ABR insert contains the natural TAG and 3' UT sequences. Addgene sequencing found an E24G point mutation--this does not alter plasmid function. Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 0
GST-Bcr pLEF
 
Resource Report
Resource Website
RRID:Addgene_38160 Bcr Homo sapiens Ampicillin PMID:14614449 Constructed by Anja Reichert. Generated in a 3-way ligation consisting of 5' 0.6 kb BamHI/SalI + 3' 3.5 kb SalI/XbaI BCR fragments into pLEF digested with BamHIxXbaI. The BCR insert contains the natural TAG and 3' UT sequences. At the 3' end there are polylinker sequences from pSK. Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 0
Bcr/Abl P210 in pAcG2T
 
Resource Report
Resource Website
RRID:Addgene_38161 Bcr/Abl P210 Homo sapiens Ampicillin Constructed by Nora Heisterkamp. Made using a 3-way ligation with 0.6 kb 5' BamHI-SalI from BCR + 3' 7.5 kb Sal I-EcoRI into pAcG2T. Not evaluated for protein production. Backbone Marker:Pharmingen; Backbone Size:8530; Vector Backbone:pAcG2T; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 0
pPK719
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_38149 cbr-unc-119::FRT*::galk::FRT* Caenorhabditis elegans Ampicillin This plasmid carries a complementary cassette consisting of a genomic copy of the C. briggsae unc-119 gene and the selectable galK marker flanked by FRT* sites in the presumptive 3’ UTR of the Cbr-unc-119 gene. The 3.6 kb Cbr-unc-119::FRT*::galk::FRT* cassette can be targeted by recombineering to insert between nts 281:282 in the pCC1FOS fosmid vector backbone. In other words, this cassette can be readily inserted in all fosmids contained in the C. elegans library developed by Don Moerman and colleagues. We have tested the construct in fosmid recombineering and have shown that it rescues unc-119(ed3) mutants. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression, recombineering; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 1
pPK348
 
Resource Report
Resource Website
RRID:Addgene_38145 ptc-3::GFP Caenorhabditis elegans Ampicillin PMID:21215260 The pPK348 plasmid was derived by inserting the GFP cassette from pPD103.87 (Addgene plasmid 1524) flanked by XbaI ends into the unique SpeI site present in exon 8 of ptc-3 and carries the entire predicted ptc-3 locus comprised of a 6.9 kb genomic coding region fused in-frame to GFP and more than 5 kb of 5′ upstream sequence, including the putative promoter Please note that Addgene's sequencing results identified several mismatches in the region of bp#722-824 when compared to the full plasmid sequence provided by the depositing laboratory. The depositor states that these mismatches are not a concern for the function of the plasmid. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 0
pPK700
 
Resource Report
Resource Website
RRID:Addgene_38146 let-60p::ptc-3::gfp Caenorhabditis elegans Ampicillin PMID:21215260 The pPK700 plasmid was derived by ligating the let-60 promoter region to ptc-3::gfp expression cassette, which was PCR amplified from pPK348 (Addgene plasmid 38145) Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:19 0
RCIscript-GoldyTALEN
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_38142 GoldyTALEN Synthetic Ampicillin PMID:23027955 Please note that this plasmid can be prone to recombination in bacteria. We recommend storing and propagating the construct in Stbl3 cells and screen 4-6 colonies by sequencing with TAL_F1 (ttggcgtcggcaaacagtgg) primer. The F1 origin feature in the full plasmid sequence is in reverse compliment orientation. Please view Addgene's quality control sequence for the most accurate information. The flipped orientation does not affect the SacI site necessary to linearize the plasmid. For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899). For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson Backbone Size:2900; Vector Backbone:pBSK; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin Truncate at N and C terminous 2026-08-15 01:14:19 18
pC-GoldyTALEN
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_38143 GoldyTALEN Synthetic Ampicillin PMID:23027955 For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899). For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson Backbone Size:4000; Vector Backbone:pBSK; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Truncate at N and C terminous 2026-08-15 01:14:19 12

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.