Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,959 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pET SUMO-syt7 C2A-2A 2B
 
Resource Report
Resource Website 		RRID:Addgene_213626 syt7 C2A-2A 2B Mus musculus Kanamycin PMID:38012142 Vector Backbone:pET SUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin F167A, F229A, R363H 2026-08-15 01:29:08 0
pcDNA3.1-HA-mSTING
 
Resource Report
Resource Website 		RRID:Addgene_214157 STING Mus musculus Ampicillin PMID:34290407 Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:29:07 0
pcDNA3.1-HA-mSTING (N153S)
 
Resource Report
Resource Website 		RRID:Addgene_214158 STING (N153S) Mus musculus Ampicillin PMID:26235147 Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin N153S 2026-08-15 01:29:07 0
pcDNA3.1-mGCC2-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_214166 GCC2 Mus musculus Ampicillin PMID:36379959 Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:29:07 0
pET SUMO-FL-syt7
 
Resource Report
Resource Website 		RRID:Addgene_213630 FL-syt7 Mus musculus Kanamycin PMID:38012142 Vector Backbone:pET SUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:29:08 0
Anti-MOG [L94/54]
 
Resource Report
Resource Website 		RRID:Addgene_190296 anti-MOG (Rattus norvegicus) recombinant Mouse monoclonal antibody Mus musculus Ampicillin PMID:30667360 This is a recombinant antibody derived from RRID: AB_2895697. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:29:08 0
pF(UG) hSyn SYT7alpha-HaloTag P2A PM-msGFP
 
Resource Report
Resource Website 		RRID:Addgene_179717 SYT7 Mus musculus Ampicillin PMID:34543184 Vector Backbone:PFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:29:22 0
pMRX-mSTING-EGFP
 
Resource Report
Resource Website 		RRID:Addgene_214148 STING Mus musculus Ampicillin PMID:34290407 Vector Backbone:pMRX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:29:23 0
OptoProfilin
 
Resource Report
Resource Website 		RRID:Addgene_208286 Cry2 - mCherry - Profilin.WT Mus musculus Kanamycin PMID:38457348 Please visit https://doi.org/10.1101/2023.10.04.560945 for bioRxiv preprint. Backbone Marker:Clontech; Backbone Size:4018; Vector Backbone:mCherry N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Profilin WT (Mus musculus) 2026-08-15 01:29:25 0
U6-sgRNAs-Crym
 
Resource Report
Resource Website 		RRID:Addgene_200067 U6-3xsgRNA-Crym Mus musculus Ampicillin PMID:38418885 Backbone Marker:Khakh lab; Backbone Size:3472; Vector Backbone:PZac2.1; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:29:25 0
GfaABC1D-Crym-BioID2-BioID2
 
Resource Report
Resource Website 		RRID:Addgene_200070 GfaABC1D-Crym-BioID2-BioID2 Mus musculus Ampicillin PMID:38418885 Backbone Size:3037; Vector Backbone:PZac2.1; Vector Types:Mouse Targeting, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:29:25 0
mNeonGreen-P2A-3xFLAG-msEEA1 HDR template
 
Resource Report
Resource Website 		RRID:Addgene_214990 EEA1 Mus musculus Ampicillin Target site is: CCGGCCAAACCATGTTTCGAAGG (AGG is the PAM). Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. Vector Backbone:pUC-GW-Amp; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:29:24 0
pAAV-BRX-eGFP-NLS
 
Resource Report
Resource Website 		RRID:Addgene_217534 BMP reporter element and miniXon casette Mus musculus Ampicillin Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:29:25 0
2xHP1bCD_W42A-IFP2.0C
 
Resource Report
Resource Website 		RRID:Addgene_215751 2xHP1bCD_W42A-IFP2.0C Mus musculus Kanamycin PMID:38554702 Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:29:26 0
pAAV-2xflox-BRX-eGFP-NLS
 
Resource Report
Resource Website 		RRID:Addgene_217535 4X BRE reporter and miniXon casette Mus musculus Ampicillin Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:29:25 0
pAAV-S5E2-FingR-PSD95-mGL
 
Resource Report
Resource Website 		RRID:Addgene_217533 ZnF-FingR-PSD95-mGreenLantern Mus musculus Ampicillin Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:29:25 0
pBabePuro-FLAG-KrasnatG12D
 
Resource Report
Resource Website 		RRID:Addgene_206865 Kras Mus musculus Ampicillin PMID:36069770 Backbone Size:5086; Vector Backbone:pBabePuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin changed Glycine 12 to Aspartic Acid 2026-08-15 01:29:26 0
pLV UBC msTMEM115-3C-3xHA-P2A-eGFP
 
Resource Report
Resource Website 		RRID:Addgene_214997 TMEM115 Mus musculus Ampicillin Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. Vector Backbone:pLV UBC; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:29:33 0
pEGFP-C1-deltaExon16-17
 
Resource Report
Resource Website 		RRID:Addgene_209564 Shtn1 long isoform with E16-17 deletion Mus musculus Kanamycin PMID:30733148 Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Exon16 and 17 deletion 2026-08-15 01:29:08 0
pFlare9A-Clip2E9 Mutant
 
Resource Report
Resource Website 		RRID:Addgene_209575 Clip2 Mus musculus Kanamycin PMID:30733148 Vector Backbone:pFlare9A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin ACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTGCACAGGCACACATACTAAATGAATAAATAAAATGCACCTAACAAACAAAGAAAGACTGACTCTTTAAATCCCACAAAGGAAGAAACTGGGGTACCCATAGCCACTGCGTTATCAGAGGCTGGCAAGGGGTGGTTCCCAGAGCCTCTTCTGCCTTGAACACACGCCCAGCTAGCCCCAGTGATGGGAGGGCACCCAGGAGAAAGCAATTCCGGCTCATTGAAGTCTTGTTCACGGAAGATGACGCACGGAATATTCCTTTCCCCACGTCCCTGCCTTCCCTGTCCACCCTGCCATCCCTCCCCCACCCCCGCCCTGGGTGGAGCAGACCCAGACCCAGCTGGAGCACGCGCGCATTGGGGAGCTGGAGCAGAGCCTGCTATTGGAGAAGGCGCAGGCCGAGCGGCTGCTCAGAGAATTAGCGGATAACAGGGTAAACCGCGCCTGCCACTGTCACCCACCCGGCCAGCGCCTTGGCCCCTAGATGCCCCCTTTGCTTTTTAAATCATTTCCTCTGCCATCACAATGGCTCCTCTTACTATTGCTTTTTGGAGACCCTTCTGAACTCCCCTCTGGGAGGGAAGCTGAGATTTAGAGTCAAGCTCACTGTGGCCAAGTAGTGCTCTTAGGGAAGGGGGGTTTGGTCCTCTGGGATTTCTTCCAAGTTCATTGCTCCTTGAGCAGAGGTGTCTCTGTGAGACCTTCCCTGTGCCTCCCTCCTGTCCCTTGCCAGAAAGAAGCCTTCTTGGAGTGGCCTGCCCCTTACTTGGATAGACATGGGCTTCCTTGGCAGGAATGCAGACCCAGAGTGTTCTAGCCTAGAGAATCTTAAGATGGCAGCAGAGAGCCAACCTGGAGGACGGATCCATAGTCGACC 2026-08-15 01:29:08 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch