Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: Luciferase_sgRNA
Vector Backbone Description: Backbone Size:13970; Vector Backbone:lentiCRISPRv2 (LCV2) (Addgene plasmid #52961); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32694731
Proper citation: RRID:Addgene_155094 Copy
Species: Other
Genetic Insert: LacZ_sgRNA_2
Vector Backbone Description: Backbone Size:14744; Vector Backbone:LCV2_mCherry; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32694731
Proper citation: RRID:Addgene_155108 Copy
Species: Other
Genetic Insert: Luciferase_sgRNA
Vector Backbone Description: Backbone Size:14744; Vector Backbone:LCV2_mCherry; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32694731
Proper citation: RRID:Addgene_155109 Copy
Species: Other
Genetic Insert: LacZ_sgRNA_2
Vector Backbone Description: Backbone Size:14753; Vector Backbone:LCV2_mClover3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32694731
Proper citation: RRID:Addgene_155103 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Proper citation: RRID:Addgene_156401 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Proper citation: RRID:Addgene_156400 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Proper citation: RRID:Addgene_156389 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Proper citation: RRID:Addgene_156399 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Comments: Addgene QC identified a common point of recombination in the promoter region. Requesting scientists should screen multiple colonies by PCR using GCGTCTCTGAATGCCAGCAC and GACTGAGCTGGACAACCATG and selecting an appropriately sized clone.
Proper citation: RRID:Addgene_156394 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Proper citation: RRID:Addgene_156397 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Proper citation: RRID:Addgene_156393 Copy
Species: Other
Genetic Insert: target_42_mut_G
Vector Backbone Description: Backbone Size:5527; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32109416
Comments: Non-cognate target for the SNIPR with a mismatch at base 42
Proper citation: RRID:Addgene_139467 Copy
Species: Other
Genetic Insert: Target_WT
Vector Backbone Description: Backbone Size:5527; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32109416
Comments: Cognate target for the SNIPR
Proper citation: RRID:Addgene_139465 Copy
Species: Other
Genetic Insert: Target_mut36
Vector Backbone Description: Backbone Size:5527; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32109416
Comments: Non-cognate target for the SNIPR with a mismatch at base 36
Please note: Plasmid contains a TCG nucleotide deletion in the Target_mut_36 sequence. This mutation is not in a key region of the plasmid and should not affect its function.
Proper citation: RRID:Addgene_139466 Copy
Species: Other
Genetic Insert: m6A-Tracer
Vector Backbone Description: Backbone Size:3203; Vector Backbone:pRN3P; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31118510
Proper citation: RRID:Addgene_139403 Copy
Species: Other
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:doi:10.1038/nchembio.1366; Backbone Size:14245; Vector Backbone:pKW20088; Vector Types:CRISPR, Synthetic Biology, Proof-of-concept test target of a in filamentous fungi.; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32526136
Comments: The PelcA-mCherry has no observable basal expression in Aspergillus nidulans, constituting a good test target for CRISPRa. Also contains PacI NotI sites to clone other components, and allows cloning in Saccharomyces cerevisiae. The mCherry mutation G174D does not appear to affect fluorescence.
Proper citation: RRID:Addgene_140202 Copy
Species: Other
Genetic Insert: gRNA1+scaffold+H1promoter+gRNA2
Vector Backbone Description: Vector Backbone:pDECKO_mCherry; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35619054
Proper citation: RRID:Addgene_140109 Copy
Species: Other
Genetic Insert: gRNA1+scaffold+H1promoter+gRNA2
Vector Backbone Description: Vector Backbone:pDECKO_mCherry; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35619054
Proper citation: RRID:Addgene_140098 Copy
Species: Other
Genetic Insert: ZIKVA-GFP
Vector Backbone Description: Backbone Marker:Invitrogen modified by Ie-Ming Shih; Backbone Size:7057; Vector Backbone:pLenti-puro (Addgene Plasmid #39481); Vector Types:Mammalian Expression, Lentiviral, Low expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31919100
Comments: The ZIKVA-GFP reporter is not suitable for transient transfection as the reporter has a basal background that makes it sensitive to the levels of expression: If the expression is too high the background will mask the signal produced by the reporter - If the expression is too low you won’t detect enough signal over the background. Our recommendation is to use the pLenti-ZIKVA-GFP-puro construct to pack lentiviral particles with the psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) plasmids, generate stable cell lines and sort cell subpopulations with different levels of the reporter's basal background before testing them. The best reporter cells will be those with the highest signal-to-noise ratio upon ZIKV infection.
Proper citation: RRID:Addgene_140090 Copy
Species: Other
Genetic Insert: Coat protein of bacteriphage PP7
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pIRES2 DsRed-Express; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31765565
Comments: CDS of PP7CP (amplified from pPP7_mCherry, ID: 61763) was inserted between SalI and BamHI sites of pTAPmyc-T2A-tagRFP (ID: 140278).
Proper citation: RRID:Addgene_140262 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
