Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pSuper.Retro.Puro-WDR5 shRNA 2 Resource Report Resource Website |
RRID:Addgene_59975 | WDR5 shRNA | Homo sapiens | Ampicillin | PMID:24793694 | Backbone Marker:OligoEngine; Backbone Size:6349; Vector Backbone:pSuper.Retro.Puro; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:28 | 0 | ||
|
p3XFLAG-CMV-14-WDR5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_59974 | WDR5 | Homo sapiens | Ampicillin | PMID:24793694 | Backbone Marker:Sigma-Aldrich; Backbone Size:6300; Vector Backbone:p3XFLAG-CMV-14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:27 | 6 | ||
|
pcDNA3-mDIS3-FLAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_60046 | DIS3 | Mus musculus | Ampicillin | PMID:25175028 | Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:28 | 1 | ||
|
pEF1-puro/hpb1 Resource Report Resource Website |
RRID:Addgene_59976 | human integrin b1 headpiece | Homo sapiens | Ampicillin | Backbone Size:6000; Vector Backbone:pEF1-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:27 | 0 | |||
|
pCMX-PL1-WDR5 Resource Report Resource Website |
RRID:Addgene_59970 | WDR5 | Homo sapiens | Ampicillin | PMID:24793694 | Backbone Size:4500; Vector Backbone:pCMX-PL1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:27 | 0 | ||
|
pCI-FLAG-mTUT4 Resource Report Resource Website |
RRID:Addgene_60041 | TUT4 | Mus musculus | Ampicillin | PMID:25175028 | Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:28 | 0 | ||
|
pCI-FLAG-mRRP6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_60045 | RRP6 | Mus musculus | Ampicillin | PMID:25175028 | Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:28 | 1 | ||
|
pcDNA3-FLAG-mTUT5 Resource Report Resource Website |
RRID:Addgene_60042 | TUT5 | Mus musculus | Ampicillin | PMID:25175028 | Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:28 | 0 | ||
|
pDCC5 Resource Report Resource Website |
RRID:Addgene_59984 | Cas9-D10A | Synthetic | Ampicillin | PMID:25236734 | Vector Backbone:pHW; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin | D10A | 2026-08-15 01:17:28 | 0 | |
|
pOTTC407 - pAAV EF1a eGFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_60058 | enhanced Green Fluorescent Protein | Other | Ampicillin | PMID:24746855 | Backbone Marker:Christopher Richie / OTTC / NIDA; Vector Backbone:pOTTC374 - pAAV EF1a DIO iRFP; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:28 | 10 | ||
|
Mesp-1916/-1>nls::Cas9::nls Resource Report Resource Website |
RRID:Addgene_59988 | nls::Cas9::nls | Streptococcus pyogenes | Ampicillin | PMID:25336740 | Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83. | Vector Backbone:pCESAx; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | Reverted mutations from dCas9 to wiltdtype | 2026-08-15 01:17:27 | 0 |
|
Eef1a-1955/-1>nls::Cas9::nls Resource Report Resource Website 1+ mentions |
RRID:Addgene_59987 | nls::Cas9::nls | Streptococcus pyogenes | Ampicillin | PMID:25336740 | Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83. | Vector Backbone:pCESAx; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | Reverted mutations from dCas9 to wiltdtype | 2026-08-15 01:17:28 | 4 |
|
Nanog-2A-mCherry Resource Report Resource Website 10+ mentions |
RRID:Addgene_59995 | Nanog | Mus musculus | Ampicillin | PMID:23827708 | Vector Backbone:PCR2_TOPO; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:28 | 10 | ||
|
pLT 652 Resource Report Resource Website |
RRID:Addgene_59997 | dhc-3 | Caenorhabditis elegans | Ampicillin | PMID:25066299 | Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.) | Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | partial genomic | 2026-08-15 01:17:28 | 0 |
|
pLT 653 Resource Report Resource Website |
RRID:Addgene_59996 | dhc-3 | Caenorhabditis elegans | Ampicillin | PMID:25066299 | Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.) | Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | partial genomic | 2026-08-15 01:17:28 | 0 |
|
Gal4pBS1-Pleum Resource Report Resource Website |
RRID:Addgene_59993 | promoter | Saccharomyces cerevisiae | Ampicillin | PMID:22565375 | Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:28 | 0 | ||
|
Gal4pBS2-Pleum Resource Report Resource Website |
RRID:Addgene_59992 | promoter | Saccharomyces cerevisiae | Ampicillin | PMID:22565375 | Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:28 | 0 | ||
|
RFN_EGFP_47 Resource Report Resource Website |
RRID:Addgene_60071 | pair of multiplex gRNAs targeting EGFP | Ampicillin | PMID:24770325 | Left gRNA target site: AAGTTCAGCGTGTCCGGCGA Right gRNA target site: CCGTCCAGCTCGACCAGGAT | Backbone Marker:Joung lab (Addgene plasmid # 53370); Vector Backbone:pSQT1313; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:28 | 0 | ||
|
GFP-CYLD-STOP Resource Report Resource Website |
RRID:Addgene_60077 | Cylindromatosis | Homo sapiens | Ampicillin | PMID:17495026 | Backbone Marker:Life Technologies; Backbone Size:2600; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:28 | 0 | ||
|
pLPNPX1 Resource Report Resource Website |
RRID:Addgene_60126 | Ampicillin | Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:29 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.