Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pXCX.CMV.tTA.WPRE Resource Report Resource Website |
RRID:Addgene_38057 | tTA | Ampicillin | PMID:15580589 | Adenoviral plasmid for overexpression of tet transactivator (tTA) from CMV promoter with WPRE. Additional reference information for this plasmid can be found at: https://www.ncbi.nlm.nih.gov/pubmed/15542617 | Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | ||
|
pXCX.Syn.tTA.WPRE Resource Report Resource Website |
RRID:Addgene_38059 | tTA | Ampicillin | PMID:15580589 | Adenoviral plasmid for overexpression of tet transactivator (tTA) from Synapsin promoter with WPRE. Additional reference information for this plasmid can be found at: https://www.ncbi.nlm.nih.gov/pubmed/15542617 | Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | ||
|
pXCX.Syn.EGFP Resource Report Resource Website |
RRID:Addgene_38054 | EGFP | Ampicillin | PMID:11991741 | Adenoviral plasmid for overexpression of EGFP from synapsin promoter | Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | ||
|
pXCX.TRE.EGFP.WPRE Resource Report Resource Website |
RRID:Addgene_38060 | EGFP | Ampicillin | PMID:15580589 | Adenoviral plasmid for overexpression of EGFP from tetracycline responsive element (TRE), intended to be used in conjucntion with one of the plasmids expressing tet transactivator (tTA), such as Addgene plasmid #'s 38056, 38057, 38058 or 38059. Additional reference information for this plasmid can be found at: https://www.ncbi.nlm.nih.gov/pubmed/15542617 | Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | ||
|
MSCV-N E1B 19k Resource Report Resource Website |
RRID:Addgene_38047 | E1B 19K | Human adenovirus 5 | Ampicillin | PMID:22810586 | Note that the Gateway cloning reaction has left several vector-based nucleotides in frame with the 3' end of the insert, adding several amino acid residues [STFLYKVVR] fused to the C-terminus of translated protein. | Backbone Size:8162; Vector Backbone:MSCV-N FLAGHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | |
|
pCA-FLEX Resource Report Resource Website |
RRID:Addgene_38041 | Ampicillin | PMID:22681690 | Backbone Marker:Masatoshi Takeichi; Backbone Size:4839; Vector Backbone:CA-MCS; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | ||||
|
pAAV-EF1a-FLEX-TVA-mCherry Resource Report Resource Website 10+ mentions |
RRID:Addgene_38044 | Avian sarcoma and leukemia virus receptor 950 | Synthetic | Ampicillin | PMID:22681690 | Backbone Marker:Stratagene; Backbone Size:5604; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 23 | ||
|
pXCX.CMV.CREB.WPRE Resource Report Resource Website |
RRID:Addgene_38050 | CREB | Rattus norvegicus | Ampicillin | PMID:15129168 | Adenoviral plasmid for overexpression of CREB from CMV promoter | Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | |
|
Bcr/Abl P190-pLEF Resource Report Resource Website |
RRID:Addgene_38159 | BCR/ABL P190 | Homo sapiens | Ampicillin | PMID:18070886 | Constructed by Suparna Mishra. Generated in a 3-way ligation consisting of 5' 0.75 kb BamHI/Sal I + 3' 6.3 kb Sal I/EcoRI BCR/ABL fragments into pLEF digested with BamHIxEcoRI. The ABL part of the insert contains the natural TAG and 3' UT sequences. Addgene NGS identified a sequence discrepancy at nucleotide 3168 resulting in a T117M mutation in the ABL-1 sequence, relative to Genbank ID NP_005148.2 and Addgene Plasmid #38158. This is not a known polymorphism and the effect of this, if any, on the protein is not known. | Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | T117M in c-ABL1 | 2026-08-15 01:14:19 | 0 |
|
EYFP-Abr in pCCL-cppt178-MNDU3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_38155 | Abr | Homo sapiens | Ampicillin | PMID:17116687 | Constructed by Jess Cunnick. Abr was first subcloned into pEYFP-C1 Bgl II x KpnI as a 0.4 kb 5' BamHI/BstEII + 2.2 kb BstEII- KpnI fragment. The EYFP-Abr fusion was isolated as a 5' AgeI- 3' KpnI fragment and inserted into pCCL-cppt178-MNDU3-X3 digested with Xma I x Kpn I. | Backbone Marker:Don Kohn [email protected]; Backbone Size:6600; Vector Backbone:pCCL-cppt178-MNDU3; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 1 | |
|
Abr-pLEF Resource Report Resource Website |
RRID:Addgene_38157 | ABR | Homo sapiens | Ampicillin | PMID:18070886 | Constructed by Suparna Mishra. Generated in a 3-way ligation consisting of 5' 0.4 kb BamHI/BstEII + 3' 2.2 kb BstEII/EcoRI ABR fragments into pLEF digested with BamHIxEcoRI. The ABR insert contains the natural TAG and 3' UT sequences. Addgene sequencing found an E24G point mutation--this does not alter plasmid function. | Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | |
|
GST-Bcr pLEF Resource Report Resource Website |
RRID:Addgene_38160 | Bcr | Homo sapiens | Ampicillin | PMID:14614449 | Constructed by Anja Reichert. Generated in a 3-way ligation consisting of 5' 0.6 kb BamHI/SalI + 3' 3.5 kb SalI/XbaI BCR fragments into pLEF digested with BamHIxXbaI. The BCR insert contains the natural TAG and 3' UT sequences. At the 3' end there are polylinker sequences from pSK. | Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | |
|
Bcr/Abl P210 in pAcG2T Resource Report Resource Website |
RRID:Addgene_38161 | Bcr/Abl P210 | Homo sapiens | Ampicillin | Constructed by Nora Heisterkamp. Made using a 3-way ligation with 0.6 kb 5' BamHI-SalI from BCR + 3' 7.5 kb Sal I-EcoRI into pAcG2T. Not evaluated for protein production. | Backbone Marker:Pharmingen; Backbone Size:8530; Vector Backbone:pAcG2T; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | ||
|
pPK719 Resource Report Resource Website 1+ mentions |
RRID:Addgene_38149 | cbr-unc-119::FRT*::galk::FRT* | Caenorhabditis elegans | Ampicillin | This plasmid carries a complementary cassette consisting of a genomic copy of the C. briggsae unc-119 gene and the selectable galK marker flanked by FRT* sites in the presumptive 3’ UTR of the Cbr-unc-119 gene. The 3.6 kb Cbr-unc-119::FRT*::galk::FRT* cassette can be targeted by recombineering to insert between nts 281:282 in the pCC1FOS fosmid vector backbone. In other words, this cassette can be readily inserted in all fosmids contained in the C. elegans library developed by Don Moerman and colleagues. We have tested the construct in fosmid recombineering and have shown that it rescues unc-119(ed3) mutants. | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression, recombineering; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 1 | ||
|
pPK348 Resource Report Resource Website |
RRID:Addgene_38145 | ptc-3::GFP | Caenorhabditis elegans | Ampicillin | PMID:21215260 | The pPK348 plasmid was derived by inserting the GFP cassette from pPD103.87 (Addgene plasmid 1524) flanked by XbaI ends into the unique SpeI site present in exon 8 of ptc-3 and carries the entire predicted ptc-3 locus comprised of a 6.9 kb genomic coding region fused in-frame to GFP and more than 5 kb of 5′ upstream sequence, including the putative promoter Please note that Addgene's sequencing results identified several mismatches in the region of bp#722-824 when compared to the full plasmid sequence provided by the depositing laboratory. The depositor states that these mismatches are not a concern for the function of the plasmid. | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | |
|
pPK700 Resource Report Resource Website |
RRID:Addgene_38146 | let-60p::ptc-3::gfp | Caenorhabditis elegans | Ampicillin | PMID:21215260 | The pPK700 plasmid was derived by ligating the let-60 promoter region to ptc-3::gfp expression cassette, which was PCR amplified from pPK348 (Addgene plasmid 38145) | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | |
|
RCIscript-GoldyTALEN Resource Report Resource Website 10+ mentions |
RRID:Addgene_38142 | GoldyTALEN | Synthetic | Ampicillin | PMID:23027955 | Please note that this plasmid can be prone to recombination in bacteria. We recommend storing and propagating the construct in Stbl3 cells and screen 4-6 colonies by sequencing with TAL_F1 (ttggcgtcggcaaacagtgg) primer. The F1 origin feature in the full plasmid sequence is in reverse compliment orientation. Please view Addgene's quality control sequence for the most accurate information. The flipped orientation does not affect the SacI site necessary to linearize the plasmid. For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899). For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson | Backbone Size:2900; Vector Backbone:pBSK; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin | Truncate at N and C terminous | 2026-08-15 01:14:19 | 18 |
|
pC-GoldyTALEN Resource Report Resource Website 10+ mentions |
RRID:Addgene_38143 | GoldyTALEN | Synthetic | Ampicillin | PMID:23027955 | For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899). For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson | Backbone Size:4000; Vector Backbone:pBSK; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Truncate at N and C terminous | 2026-08-15 01:14:19 | 12 |
|
p1177-X1-8 Resource Report Resource Website |
RRID:Addgene_38150 | Carboxypeptidase A | M. anisopliae | Ampicillin | PMID:21073956 | Backbone Marker:Invitrogen; Backbone Size:6526; Vector Backbone:pFastBac-1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 0 | ||
|
pcDNA4-FLAG-Jhdm2a Resource Report Resource Website 1+ mentions |
RRID:Addgene_38136 | Jhdm2a | Mus musculus | Ampicillin | PMID:22722204 | Backbone Size:5100; Vector Backbone:pcDNA4/myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | protein starts at aa115 | 2026-08-15 01:14:19 | 3 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.