Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: ALK
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533785
Proper citation: RRID:Addgene_116712 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8595; Vector Backbone:pPRIME-CMV-Neo; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:16141338
Comments: CMV promoter transcribes Neo and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
Proper citation: RRID:Addgene_11665 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8226; Vector Backbone:pPRIME-TET-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:16141338
Comments: TET promoter (minimal CMV promoter containing seven upstream Tet-operator sites) transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
Proper citation: RRID:Addgene_11662 Copy
Species: Other
Genetic Insert: glycosylphosphatidylinositol-mCherry-mCherry
Vector Backbone Description: Vector Backbone:mCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30006597
Proper citation: RRID:Addgene_127812 Copy
Species: Other
Genetic Insert: mRuby3
Vector Backbone Description: Vector Backbone:mEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30006597
Proper citation: RRID:Addgene_127808 Copy
Species: Synthetic
Genetic Insert: Synthetic CRISPR array containing four identical T. thermophilus spacers
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3920; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31278272
Proper citation: RRID:Addgene_127764 Copy
Genetic Insert: Empty backbone
Vector Backbone Description: Vector Backbone:pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene#62988); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: pSpCas9(BB)-2A-Puro (PX459) V2.0 was digested with EcoRI to remove the T2A-Puro cassette, and a P2A-Neomycin cassette was amplified by PCR, digested with EcoRI, and ligated.
Proper citation: RRID:Addgene_127762 Copy
Species: Synthetic
Genetic Insert: Synthetic construct isolate AAV-PHP.B4 VP1 gene
Vector Backbone Description: Backbone Size:6314; Vector Backbone:pUC57-mini; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32313222
Comments: Please note that this is a non-standard rep-cap construct. It uses a tTA-TRE amplification loop to increase Capsid expression and AAV production. We find that this system increases AAV titers 1.5-5 fold (Ben Deverman, Bryan Simpson and Paul Patterson, unpublished data). This is a tet-off system, so no dox or tet is needed to turn it on. It can be used like any other rep-cap plasmid. This system should only present a problem if the rAAV genome to be packaged has a tet responsive element that directs expression of a protein that affected the health of the production cells. The introduction of an XbaI restriction site for ease of cloning introduces a K449R mutation, which does not have an overt effect on vector production or transduction.
Proper citation: RRID:Addgene_127849 Copy
Species: Mus musculus
Genetic Insert: myc,
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:5172; Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30814732
Proper citation: RRID:Addgene_127890 Copy
Species: Homo sapiens
Genetic Insert: TET3-HxDmut
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6200; Vector Backbone:PEF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23563267
Proper citation: RRID:Addgene_127896 Copy
Species: Homo sapiens
Genetic Insert: GFP-Puro-H3F-AID
Vector Backbone Description: Vector Backbone:pCRIS-PITCh; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31138654
Proper citation: RRID:Addgene_127885 Copy
Genetic Insert: ShTnsB, ShTnsC, ShTniQ, ShCas12k
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31171706
Proper citation: RRID:Addgene_127922 Copy
Genetic Insert: ShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA scaffold for guide cloning (LguI sites)
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31171706
Proper citation: RRID:Addgene_127921 Copy
Genetic Insert: PSP1 target (GGTT PAM)
Vector Backbone Description: Vector Backbone:pACYC; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31171706
Proper citation: RRID:Addgene_127926 Copy
Genetic Insert: KanR, R6K origin of replication
Vector Backbone Description: Vector Backbone:pUC19, R6K origin of replication; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31171706
Proper citation: RRID:Addgene_127924 Copy
Vector Backbone Description: Vector Backbone:pMD19-T; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33037196
Comments: Gateway expression cassette from pEAQ-HT-DEST1
Proper citation: RRID:Addgene_127918 Copy
Species: Synthetic
Genetic Insert: 4 repeats of COX8 signal peptide plus GCaMP6f
Vector Backbone Description: Backbone Size:5433; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31862210
Proper citation: RRID:Addgene_127870 Copy
Species: Arabidopsis thaliana
Genetic Insert: OsTIR
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:Transposon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34106828
Proper citation: RRID:Addgene_127910 Copy
Genetic Insert: gRNA for Human 3' HP1a
Vector Backbone Description: Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34106828
Proper citation: RRID:Addgene_127907 Copy
Species: Homo sapiens
Genetic Insert: HP1
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:Donor plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34106828
Proper citation: RRID:Addgene_127906 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
