Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pHAGE-ALK Resource Report Resource Website 1+ mentions |
RRID:Addgene_116712 | ALK | Homo sapiens | Ampicillin | PMID:29533785 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | WT | 2026-08-15 01:02:47 | 1 | |
|
pPRIME-CMV-Neo-FF3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11665 | FF3 | Firefly | Chloramphenicol | PMID:16141338 | CMV promoter transcribes Neo and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site. Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC) | Backbone Size:8595; Vector Backbone:pPRIME-CMV-Neo; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:02:46 | 3 | |
|
pPRIME-TET-GFP-FF3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11662 | FF3 | Firefly | Chloramphenicol | PMID:16141338 | TET promoter (minimal CMV promoter containing seven upstream Tet-operator sites) transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site. Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC) | Backbone Size:8226; Vector Backbone:pPRIME-TET-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:02:46 | 1 | |
|
GPI_2xmCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_127812 | glycosylphosphatidylinositol-mCherry-mCherry | Other | Kanamycin | PMID:30006597 | Vector Backbone:mCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:04:40 | 3 | ||
|
mRuby3-C1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_127808 | mRuby3 | Other | Kanamycin | PMID:30006597 | Vector Backbone:mEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:04:40 | 3 | ||
|
pACYC-TtCas6-4xcrRNA4.5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_127764 | Synthetic CRISPR array containing four identical T. thermophilus spacers | Synthetic | Chloramphenicol | PMID:31278272 | Backbone Marker:Novagen; Backbone Size:3920; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:04:39 | 4 | ||
|
pSpCas9(BB)-2A-Neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_127762 | Empty backbone | Ampicillin | pSpCas9(BB)-2A-Puro (PX459) V2.0 was digested with EcoRI to remove the T2A-Puro cassette, and a P2A-Neomycin cassette was amplified by PCR, digested with EcoRI, and ligated. | Vector Backbone:pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene#62988); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:39 | 3 | |||
|
pUCmini-iCAP-PHP.B4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_127849 | Synthetic construct isolate AAV-PHP.B4 VP1 gene | Synthetic | Ampicillin | PMID:32313222 | Please note that this is a non-standard rep-cap construct. It uses a tTA-TRE amplification loop to increase Capsid expression and AAV production. We find that this system increases AAV titers 1.5-5 fold (Ben Deverman, Bryan Simpson and Paul Patterson, unpublished data). This is a tet-off system, so no dox or tet is needed to turn it on. It can be used like any other rep-cap plasmid. This system should only present a problem if the rAAV genome to be packaged has a tet responsive element that directs expression of a protein that affected the health of the production cells. The introduction of an XbaI restriction site for ease of cloning introduces a K449R mutation, which does not have an overt effect on vector production or transduction. | Backbone Size:6314; Vector Backbone:pUC57-mini; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:40 | 1 | |
|
MSCV-myc-CAR-2A-Thy1.1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_127890 | myc, | Mus musculus | Ampicillin | PMID:30814732 | Backbone Marker:Clonetech; Backbone Size:5172; Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:41 | 3 | ||
|
FH-TET3-HxDmut-pEF Resource Report Resource Website 1+ mentions |
RRID:Addgene_127896 | TET3-HxDmut | Homo sapiens | Ampicillin | PMID:23563267 | Backbone Marker:Invitrogen; Backbone Size:6200; Vector Backbone:PEF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:41 | 1 | ||
|
pN-PITCh-FAID Resource Report Resource Website 1+ mentions |
RRID:Addgene_127885 | GFP-Puro-H3F-AID | Homo sapiens | Ampicillin | PMID:31138654 | Vector Backbone:pCRIS-PITCh; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:41 | 1 | ||
|
pHelper_ShCAST Resource Report Resource Website 1+ mentions |
RRID:Addgene_127922 | ShTnsB, ShTnsC, ShTniQ, ShCas12k | Ampicillin | PMID:31171706 | Vector Backbone:pUC19; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:41 | 4 | |||
|
pHelper_ShCAST_sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_127921 | ShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA scaffold for guide cloning (LguI sites) | Ampicillin | PMID:31171706 | Vector Backbone:pUC19; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:41 | 9 | |||
|
pTarget_CAST Resource Report Resource Website 1+ mentions |
RRID:Addgene_127926 | PSP1 target (GGTT PAM) | Chloramphenicol | PMID:31171706 | Vector Backbone:pACYC; Vector Types:; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:04:41 | 7 | |||
|
pDonor_ShCAST_kanR Resource Report Resource Website 10+ mentions |
RRID:Addgene_127924 | KanR, R6K origin of replication | Kanamycin | PMID:31171706 | Vector Backbone:pUC19, R6K origin of replication; Vector Types:; Bacterial Resistance:Kanamycin | 2026-08-15 01:04:41 | 13 | |||
|
p35S-GW-3Avi Resource Report Resource Website 1+ mentions |
RRID:Addgene_127918 | Chloramphenicol and Ampicillin | PMID:33037196 | Gateway expression cassette from pEAQ-HT-DEST1 | Vector Backbone:pMD19-T; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:04:41 | 1 | |||
|
CMV-Mito4x-GCaMP6f Resource Report Resource Website 1+ mentions |
RRID:Addgene_127870 | 4 repeats of COX8 signal peptide plus GCaMP6f | Synthetic | Ampicillin | PMID:31862210 | Backbone Size:5433; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:41 | 4 | ||
|
pEf1a OsTIR ires NEO pA T2BH Resource Report Resource Website 1+ mentions |
RRID:Addgene_127910 | OsTIR | Arabidopsis thaliana | Ampicillin | PMID:34106828 | Vector Backbone:pBSK; Vector Types:Transposon; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:41 | 1 | ||
|
pX330 Human 3' HP1a gRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_127907 | gRNA for Human 3' HP1a | Ampicillin | PMID:34106828 | Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:41 | 2 | |||
|
Human 3' HP1a AID GFP PuroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_127906 | HP1 | Homo sapiens | Ampicillin | PMID:34106828 | Vector Backbone:pBSK; Vector Types:Donor plasmid; Bacterial Resistance:Ampicillin | Inserting GFP AID 2A Puro into mouse 3' Hp1a | 2026-08-15 01:04:41 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
