Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 208 showing 4141 ~ 4160 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_60310

http://www.addgene.org/60310

Species: Homo sapiens
Genetic Insert: SLC2A2 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr3; start: 172177343 end: 172179831 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGTGTTTGAGCTCCCCTGAAA Rv primer used for cloning: TGGTGGTGGTTTGCTGAACCATGT

Proper citation: RRID:Addgene_60310 Copy   


  • RRID:Addgene_60316

http://www.addgene.org/60316

Species: Homo sapiens
Genetic Insert: ACSL1 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr4; start: 185953054 end: 185954041 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCTCCCCACTATCCCAGAGGA Rv primer used for cloning: CTGGCAGGGTGCAAACATCAGC

Proper citation: RRID:Addgene_60316 Copy   


  • RRID:Addgene_60319

http://www.addgene.org/60319

Species: Homo sapiens
Genetic Insert: Non active element (nearest TSS C18orf26)
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr18; start: 50489292 end: 50489931 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCAGCCCTTGGTCAAGAATAGT Rv primer used for cloning: TGTAAGCGGTTTGGGCAATCTT

Proper citation: RRID:Addgene_60319 Copy   


  • RRID:Addgene_60323

    This resource has 10+ mentions.

http://www.addgene.org/60323

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4283; Vector Backbone:pGL4.23; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24413736
Comments: Gateway cassette was inserted between SacI and XhoI restriction sites in the MCS.

Proper citation: RRID:Addgene_60323 Copy   


  • RRID:Addgene_60321

http://www.addgene.org/60321

Species: Homo sapiens
Genetic Insert: Non active element (nearest TSS CCRN4L)
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr4; start: 139931533 end: 139932029 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCATGGTCGGATATGACAGTTT Rv primer used for cloning: CCCATGGGAATAAGGCCTGTAGA

Proper citation: RRID:Addgene_60321 Copy   


  • RRID:Addgene_60328

http://www.addgene.org/60328

Species: Saccharomyces cerevisiae
Genetic Insert: promoter
Vector Backbone Description: Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22565375

Proper citation: RRID:Addgene_60328 Copy   


  • RRID:Addgene_60327

http://www.addgene.org/60327

Species: Saccharomyces cerevisiae
Genetic Insert: promoter
Vector Backbone Description: Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22565375

Proper citation: RRID:Addgene_60327 Copy   


  • RRID:Addgene_60280

http://www.addgene.org/60280

Species: Homo sapiens
Genetic Insert: PCSK1 enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr5; start: 95655454 end: 95657341 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGATCCACCAGCCTCAGTCTC Rv primer used for cloning: TGTGTGCATACATGATGCCCTTTG

Proper citation: RRID:Addgene_60280 Copy   


  • RRID:Addgene_60287

http://www.addgene.org/60287

Species: Homo sapiens
Genetic Insert: LINGO2 inactive enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr9; start: 29215891 end: 29216522 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCAGTGGGTTGTTTGTGTTTTT Rv primer used for cloning: TTGCTATGGTTAAGGTAAATGGCACA

Proper citation: RRID:Addgene_60287 Copy   


  • RRID:Addgene_60217

http://www.addgene.org/60217

Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2571; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_60217 Copy   


http://www.addgene.org/60215

Species: Mus musculus
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2571; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_60215 Copy   


  • RRID:Addgene_60290

http://www.addgene.org/60290

Species: Homo sapiens
Genetic Insert: EDARADD inactive enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr1; start: 234595797 end: 234596272 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTTCTGCAATGTTTAATCTGC Rv primer used for cloning: GGTCTCAGCTCAGTGGTAGGG

Proper citation: RRID:Addgene_60290 Copy   


  • RRID:Addgene_60294

http://www.addgene.org/60294

Species: Homo sapiens
Genetic Insert: KIRREL3 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr11; start: 126232858 end: 126233700 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGTGTGGGAGAAAAGTCTTCA Rv primer used for cloning: TGCCTTGTGAATGGCAGAGGAG

Proper citation: RRID:Addgene_60294 Copy   


  • RRID:Addgene_60293

http://www.addgene.org/60293

Species: Homo sapiens
Genetic Insert: SLC30A8 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr8; start: 118326349 end: 118327201 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGGAGGTCAGAGTTGCCTACA Rv primer used for cloning: CATGGATTCAGGCCATTCCTGTCA

Proper citation: RRID:Addgene_60293 Copy   


  • RRID:Addgene_60298

http://www.addgene.org/60298

Species: Homo sapiens
Genetic Insert: EDN3 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr20; start: 57374048 end: 57374748 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCATTCAGAAGCCCTTTCC Rv primer used for cloning: TTCTGCACCCAGCTTTGTAAGAGG

Proper citation: RRID:Addgene_60298 Copy   


  • RRID:Addgene_60297

http://www.addgene.org/60297

Species: Homo sapiens
Genetic Insert: CDKAL1 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr6; start: 20799028 end: 20800286 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTGAGAGCGGATTTTACAGAT Rv primer used for cloning: AGCAAAAGCTGCCATGCCTA

Proper citation: RRID:Addgene_60297 Copy   


  • RRID:Addgene_60296

http://www.addgene.org/60296

Species: Homo sapiens
Genetic Insert: CDKN2BAS enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr9; start: 22123613 end: 22124279 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTCTGCATAAATTCTTTGGAACA Rv primer used for cloning: GATCCACCCACCTTGGTTTCC

Proper citation: RRID:Addgene_60296 Copy   


http://www.addgene.org/60225

Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2738; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html)

Proper citation: RRID:Addgene_60225 Copy   


http://www.addgene.org/60228

Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html) NOTE: The CBh promoter is slightly truncated. There should be no effect on function.

Proper citation: RRID:Addgene_60228 Copy   


http://www.addgene.org/60227

Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html)

Proper citation: RRID:Addgene_60227 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X