Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Authority:addgene (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

177,820 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pGL4.23 C3_31
 
Resource Report
Resource Website
RRID:Addgene_60310 SLC2A2 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr3; start: 172177343 end: 172179831 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGTGTTTGAGCTCCCCTGAAA Rv primer used for cloning: TGGTGGTGGTTTGCTGAACCATGT Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_38
 
Resource Report
Resource Website
RRID:Addgene_60316 ACSL1 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr4; start: 185953054 end: 185954041 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCTCCCCACTATCCCAGAGGA Rv primer used for cloning: CTGGCAGGGTGCAAACATCAGC Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C5_12
 
Resource Report
Resource Website
RRID:Addgene_60319 Non active element (nearest TSS C18orf26) Homo sapiens Ampicillin PMID:24413736 chromosome : chr18; start: 50489292 end: 50489931 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCAGCCCTTGGTCAAGAATAGT Rv primer used for cloning: TGTAAGCGGTTTGGGCAATCTT Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23-GW
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_60323 Chloramphenicol and Ampicillin PMID:24413736 Gateway cassette was inserted between SacI and XhoI restriction sites in the MCS. Backbone Marker:Promega; Backbone Size:4283; Vector Backbone:pGL4.23; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:17:31 12
pGL4.23 C5_14
 
Resource Report
Resource Website
RRID:Addgene_60321 Non active element (nearest TSS CCRN4L) Homo sapiens Ampicillin PMID:24413736 chromosome : chr4; start: 139931533 end: 139932029 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCATGGTCGGATATGACAGTTT Rv primer used for cloning: CCCATGGGAATAAGGCCTGTAGA Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
UASGAL-CU2-Pleum
 
Resource Report
Resource Website
RRID:Addgene_60328 promoter Saccharomyces cerevisiae Ampicillin PMID:22565375 Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
Gal4pBS24-Pleum
 
Resource Report
Resource Website
RRID:Addgene_60327 promoter Saccharomyces cerevisiae Ampicillin PMID:22565375 Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pENTR D-TOPO-C3_39
 
Resource Report
Resource Website
RRID:Addgene_60280 PCSK1 enhancer Homo sapiens Kanamycin PMID:24413736 chromosome : chr5; start: 95655454 end: 95657341 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGATCCACCAGCCTCAGTCTC Rv primer used for cloning: TGTGTGCATACATGATGCCCTTTG Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 0
pGL4.23 C2_10
 
Resource Report
Resource Website
RRID:Addgene_60287 LINGO2 inactive enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr9; start: 29215891 end: 29216522 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCAGTGGGTTGTTTGTGTTTTT Rv primer used for cloning: TTGCTATGGTTAAGGTAAATGGCACA Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
Human-Dysferlin-v1
 
Resource Report
Resource Website
RRID:Addgene_60217 Dysferlin Homo sapiens Kanamycin Backbone Marker:Invitrogen; Backbone Size:2571; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 0
Mouse-Dysferlin-Transcript-Variant2
 
Resource Report
Resource Website
RRID:Addgene_60215 Dysferlin Mus musculus Kanamycin Backbone Marker:Invitrogen; Backbone Size:2571; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 0
pGL4.23 C2_14
 
Resource Report
Resource Website
RRID:Addgene_60290 EDARADD inactive enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr1; start: 234595797 end: 234596272 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTTCTGCAATGTTTAATCTGC Rv primer used for cloning: GGTCTCAGCTCAGTGGTAGGG Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_8
 
Resource Report
Resource Website
RRID:Addgene_60294 KIRREL3 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr11; start: 126232858 end: 126233700 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGTGTGGGAGAAAAGTCTTCA Rv primer used for cloning: TGCCTTGTGAATGGCAGAGGAG Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_7
 
Resource Report
Resource Website
RRID:Addgene_60293 SLC30A8 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr8; start: 118326349 end: 118327201 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGGAGGTCAGAGTTGCCTACA Rv primer used for cloning: CATGGATTCAGGCCATTCCTGTCA Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_13
 
Resource Report
Resource Website
RRID:Addgene_60298 EDN3 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr20; start: 57374048 end: 57374748 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCATTCAGAAGCCCTTTCC Rv primer used for cloning: TTCTGCACCCAGCTTTGTAAGAGG Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_11
 
Resource Report
Resource Website
RRID:Addgene_60297 CDKAL1 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr6; start: 20799028 end: 20800286 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTGAGAGCGGATTTTACAGAT Rv primer used for cloning: AGCAAAAGCTGCCATGCCTA Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_21
 
Resource Report
Resource Website
RRID:Addgene_60296 CDKN2BAS enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr9; start: 22123613 end: 22124279 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTCTGCATAAATTCTTTGGAACA Rv primer used for cloning: GATCCACCCACCTTGGTTTCC Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
 
Resource Report
Resource Website
RRID:Addgene_60225 sgRNA Ampicillin PMID:25263330 Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html) Backbone Size:2738; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 0
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_60228 sgRNA Ampicillin PMID:25263330 Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html) NOTE: The CBh promoter is slightly truncated. There should be no effect on function. Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 2
AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITR
 
Resource Report
Resource Website
RRID:Addgene_60227 sgRNA Ampicillin PMID:25263330 Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html) Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.