Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 209 showing 4161 ~ 4180 out of 30,421 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/160134

Species: Synthetic
Genetic Insert: Plasmid library harboring a randomized 10nt PAM 5’ of target site 3
Vector Backbone Description: Vector Backbone:p11-LacY-wtx1 (Addgene plasmid #69056); Vector Types:CRISPR, Substrate for -Cas enzymes; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33547443

Proper citation: RRID:Addgene_160134 Copy   


http://www.addgene.org/160136

Species: Synthetic
Genetic Insert: SpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443

Proper citation: RRID:Addgene_160136 Copy   


http://www.addgene.org/160137

Species: Synthetic
Genetic Insert: SpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443

Proper citation: RRID:Addgene_160137 Copy   


http://www.addgene.org/160138

Species: Synthetic
Genetic Insert: AsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443

Proper citation: RRID:Addgene_160138 Copy   


  • RRID:Addgene_160350

http://www.addgene.org/160350

Species: Synthetic
Genetic Insert: His-redFAST
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778846

Proper citation: RRID:Addgene_160350 Copy   


http://www.addgene.org/160352

Species: Synthetic
Genetic Insert: lyn11-greenFAST
Vector Backbone Description: Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778846

Proper citation: RRID:Addgene_160352 Copy   


http://www.addgene.org/160357

Species: Synthetic
Genetic Insert: mito-greenFAST
Vector Backbone Description: Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778846

Proper citation: RRID:Addgene_160357 Copy   


  • RRID:Addgene_160358

http://www.addgene.org/160358

Species: Synthetic
Genetic Insert: mito-redFAST
Vector Backbone Description: Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778846

Proper citation: RRID:Addgene_160358 Copy   


  • RRID:Addgene_160349

http://www.addgene.org/160349

Species: Synthetic
Genetic Insert: His-greenFAST
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778846

Proper citation: RRID:Addgene_160349 Copy   


  • RRID:Addgene_160360

http://www.addgene.org/160360

Species: Synthetic
Genetic Insert: H2B-redFAST
Vector Backbone Description: Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778846

Proper citation: RRID:Addgene_160360 Copy   


  • RRID:Addgene_160361

    This resource has 1+ mentions.

http://www.addgene.org/160361

Species: Synthetic
Genetic Insert: FRB-greenNFAST
Vector Backbone Description: Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778846

Proper citation: RRID:Addgene_160361 Copy   


http://www.addgene.org/160365

Species: Synthetic
Genetic Insert: LifeAct-RedFAST
Vector Backbone Description: Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778846

Proper citation: RRID:Addgene_160365 Copy   


http://www.addgene.org/160366

Species: Synthetic
Genetic Insert: MAP4-greenFAST
Vector Backbone Description: Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778846

Proper citation: RRID:Addgene_160366 Copy   


  • RRID:Addgene_160399

http://www.addgene.org/160399

Species: Synthetic
Genetic Insert: 35S::vitis GRF4-GIF1 chimera
Vector Backbone Description: Backbone Size:17356; Vector Backbone:pGWB14; Vector Types:Binary vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33046875

Proper citation: RRID:Addgene_160399 Copy   


  • RRID:Addgene_160420

http://www.addgene.org/160420

Species: Synthetic
Genetic Insert: pEZY3 CMV-hyCal9
Vector Backbone Description: Vector Backbone:pEZY3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34373460

Proper citation: RRID:Addgene_160420 Copy   


  • RRID:Addgene_160421

http://www.addgene.org/160421

Species: Synthetic
Genetic Insert: iGECI
Vector Backbone Description: Backbone Size:3936; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33106681

Proper citation: RRID:Addgene_160421 Copy   


  • RRID:Addgene_160422

http://www.addgene.org/160422

Species: Synthetic
Genetic Insert: iGECI-NES
Vector Backbone Description: Backbone Size:3939; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33106681

Proper citation: RRID:Addgene_160422 Copy   


http://www.addgene.org/160424

Species: Synthetic
Genetic Insert: iGECI-NES
Vector Backbone Description: Backbone Size:3755; Vector Backbone:pAAV-CW3SL; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33106681

Proper citation: RRID:Addgene_160424 Copy   


  • RRID:Addgene_160442

    This resource has 1+ mentions.

http://www.addgene.org/160442

Species: Synthetic
Genetic Insert: promoter, RBS, mRFP1
Vector Backbone Description: Backbone Marker:iGEM Registry; Vector Backbone:BioBrick pSB1C3 vector; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:32891596

Proper citation: RRID:Addgene_160442 Copy   


http://www.addgene.org/160443

Species: Synthetic
Genetic Insert: promoter, RBS, mRFP1E_Yellow
Vector Backbone Description: Backbone Marker:iGEM Registry; Vector Backbone:BioBrick pSB1C3 vector; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:32891596

Proper citation: RRID:Addgene_160443 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X