Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pPB-tetO(hCMV1)-HA-Tet1(201R2)-IV Resource Report Resource Website |
RRID:Addgene_102421 | Tet1 | Mus musculus | Ampicillin | PMID:28504700 | The full length transcript 201 refers to the coding sequence (CDS) of Ensembl transcript Tet1-201 (transcript ID ENSMUST00000050826.13) or NCBI RefSeq NM_027384.1. This variant (isoform 2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, but the protein product retains catalytic function. | Backbone Marker:Austin Smith (Addgene plasmid# 60432); Vector Backbone:pPB-hCMV1-hNANOG-IV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Modified at the Dharmacon SMARTpool siRNA #2 target site to make it siRNA-resistant | 2026-08-15 01:00:23 | 0 |
|
pAM-35s-Lyk5-YFPn-1 Resource Report Resource Website |
RRID:Addgene_102389 | LYK5 | Arabidopsis thaliana | Ampicillin | Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:23 | 0 | |||
|
pPB-tetO(hCMV1)-HA-Tet1mHxD(201R2)-IV Resource Report Resource Website |
RRID:Addgene_102422 | Tet1 catalytic domain mutant | Mus musculus | Ampicillin | PMID:28504700 | The full length transcript 201 refers to the coding sequence (CDS) of Ensembl transcript Tet1-201 (transcript ID ENSMUST00000050826.13) or NCBI RefSeq NM_027384.1. This variant (isoform 2) lacks an alternate in-frame exon in the central coding region, compared to variant 1. | Backbone Marker:Austin Smith (Addgene plasmid# 60432); Vector Backbone:pPB-hCMV1-hNANOG-IV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | H1620Y and D1622A mutations in Tet1 catalytic domain; Modified at the Dharmacon SMARTpool siRNA #2 target site to make it siRNA-resistant | 2026-08-15 01:00:23 | 0 |
|
pPB-CAG-rtTA-IRES-Hygro Resource Report Resource Website 10+ mentions |
RRID:Addgene_102423 | tetracyclin-transactivator (rtTA) | Ampicillin | PMID:28504700 | IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers: Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG | Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:24 | 10 | ||
|
pAM-35s-CBL5-YFPc-1 Resource Report Resource Website |
RRID:Addgene_102397 | CBL5 | Arabidopsis thaliana | Ampicillin | Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:24 | 0 | |||
|
pAM-35s-CBL6-YFPc-1 Resource Report Resource Website |
RRID:Addgene_102398 | CBL6 | Arabidopsis thaliana | Ampicillin | Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:23 | 0 | |||
|
pAM-35s-Snrk2.3-YFPn-1 Resource Report Resource Website |
RRID:Addgene_102391 | SNRK2.3 | Arabidopsis thaliana | Ampicillin | Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:23 | 0 | |||
|
pAM-35s-CBL2-YFPc-1 Resource Report Resource Website |
RRID:Addgene_102394 | CBL2 | Arabidopsis thaliana | Ampicillin | Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:23 | 0 | |||
|
pLentiCRISPR sgHAL Resource Report Resource Website 1+ mentions |
RRID:Addgene_102315 | sgHAL | Homo sapiens | Ampicillin | PMID:29995852 | Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:23 | 2 | ||
|
pTR47m4-GFP Resource Report Resource Website |
RRID:Addgene_102436 | Formaldehyde repressor protein (frmR) | E. coli | Ampicillin | PMID:28921510 | Vector Backbone:pTR47m4; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:24 | 0 | ||
|
p2lox-cAMPr R626A Resource Report Resource Website |
RRID:Addgene_102437 | cAMPr | Ampicillin | PMID:29511120 | Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | PKA-R R626A | 2026-08-15 01:00:24 | 0 | ||
|
pWP1_mFTCD Resource Report Resource Website |
RRID:Addgene_102317 | Ftcd | Mus musculus | Ampicillin | PMID:29995852 | Vector Backbone:pWP1; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:23 | 0 | ||
|
p2lox-cAMPr Y205A Resource Report Resource Website |
RRID:Addgene_102438 | cAMPr | Ampicillin | PMID:29511120 | Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | PKA-C Y205A | 2026-08-15 01:00:24 | 0 | ||
|
scFv-sfGFP-DNMT3A1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_102278 | DNMT3A1 | Homo sapiens | Ampicillin | PMID:28923089 | Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:23 | 3 | ||
|
pAM-35s-CBL8-YFPc-1 Resource Report Resource Website |
RRID:Addgene_102399 | CBL8 | Arabidopsis thaliana | Ampicillin | Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:23 | 0 | |||
|
pLentiCRISPR sgFTCD_1 Resource Report Resource Website |
RRID:Addgene_102312 | sgFTCD_1 | Homo sapiens | Ampicillin | PMID:29995852 | Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:23 | 0 | ||
|
pLentiCRISPR sgFTCD_2 Resource Report Resource Website |
RRID:Addgene_102313 | sgFTCD_2 | Homo sapiens | Ampicillin | PMID:29995852 | Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:23 | 0 | ||
|
p35S:TN3-YFPn Resource Report Resource Website |
RRID:Addgene_102407 | TN3 | Arabidopsis thaliana | Ampicillin | Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:24 | 0 | |||
|
p35S::ARA6/RabF1-YFPc Resource Report Resource Website |
RRID:Addgene_102408 | ARA6 | Arabidopsis thaliana | Ampicillin | Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:23 | 0 | |||
|
pSIN-PAmCherry-mSNCA-NE Resource Report Resource Website 1+ mentions |
RRID:Addgene_102364 | PA-mCherry | Synthetic | Ampicillin | PMID:30983487 | There is a "NheI" restriction site which we artificially added between PAmCherry and SNCA-NE to facilitate cloning. i.e. 5'---PAmCherry-NheI-SNCA-NE----3' This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/) | Backbone Marker:SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.; Backbone Size:7500; Vector Backbone:pSin4-EF2-IRES-Pur; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:23 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.