Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pPB-tetO(hCMV1)-HA-Tet1(201R2)-IV
 
Resource Report
Resource Website
RRID:Addgene_102421 Tet1 Mus musculus Ampicillin PMID:28504700 The full length transcript 201 refers to the coding sequence (CDS) of Ensembl transcript Tet1-201 (transcript ID ENSMUST00000050826.13) or NCBI RefSeq NM_027384.1. This variant (isoform 2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, but the protein product retains catalytic function. Backbone Marker:Austin Smith (Addgene plasmid# 60432); Vector Backbone:pPB-hCMV1-hNANOG-IV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Modified at the Dharmacon SMARTpool siRNA #2 target site to make it siRNA-resistant 2026-08-15 01:00:23 0
pAM-35s-Lyk5-YFPn-1
 
Resource Report
Resource Website
RRID:Addgene_102389 LYK5 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
pPB-tetO(hCMV1)-HA-Tet1mHxD(201R2)-IV
 
Resource Report
Resource Website
RRID:Addgene_102422 Tet1 catalytic domain mutant Mus musculus Ampicillin PMID:28504700 The full length transcript 201 refers to the coding sequence (CDS) of Ensembl transcript Tet1-201 (transcript ID ENSMUST00000050826.13) or NCBI RefSeq NM_027384.1. This variant (isoform 2) lacks an alternate in-frame exon in the central coding region, compared to variant 1. Backbone Marker:Austin Smith (Addgene plasmid# 60432); Vector Backbone:pPB-hCMV1-hNANOG-IV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin H1620Y and D1622A mutations in Tet1 catalytic domain; Modified at the Dharmacon SMARTpool siRNA #2 target site to make it siRNA-resistant 2026-08-15 01:00:23 0
pPB-CAG-rtTA-IRES-Hygro
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_102423 tetracyclin-transactivator (rtTA) Ampicillin PMID:28504700 IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers: Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 10
pAM-35s-CBL5-YFPc-1
 
Resource Report
Resource Website
RRID:Addgene_102397 CBL5 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 0
pAM-35s-CBL6-YFPc-1
 
Resource Report
Resource Website
RRID:Addgene_102398 CBL6 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
pAM-35s-Snrk2.3-YFPn-1
 
Resource Report
Resource Website
RRID:Addgene_102391 SNRK2.3 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
pAM-35s-CBL2-YFPc-1
 
Resource Report
Resource Website
RRID:Addgene_102394 CBL2 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
pLentiCRISPR sgHAL
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_102315 sgHAL Homo sapiens Ampicillin PMID:29995852 Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 2
pTR47m4-GFP
 
Resource Report
Resource Website
RRID:Addgene_102436 Formaldehyde repressor protein (frmR) E. coli Ampicillin PMID:28921510 Vector Backbone:pTR47m4; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 0
p2lox-cAMPr R626A
 
Resource Report
Resource Website
RRID:Addgene_102437 cAMPr Ampicillin PMID:29511120 Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin PKA-R R626A 2026-08-15 01:00:24 0
pWP1_mFTCD
 
Resource Report
Resource Website
RRID:Addgene_102317 Ftcd Mus musculus Ampicillin PMID:29995852 Vector Backbone:pWP1; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
p2lox-cAMPr Y205A
 
Resource Report
Resource Website
RRID:Addgene_102438 cAMPr Ampicillin PMID:29511120 Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin PKA-C Y205A 2026-08-15 01:00:24 0
scFv-sfGFP-DNMT3A1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_102278 DNMT3A1 Homo sapiens Ampicillin PMID:28923089 Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 3
pAM-35s-CBL8-YFPc-1
 
Resource Report
Resource Website
RRID:Addgene_102399 CBL8 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
pLentiCRISPR sgFTCD_1
 
Resource Report
Resource Website
RRID:Addgene_102312 sgFTCD_1 Homo sapiens Ampicillin PMID:29995852 Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
pLentiCRISPR sgFTCD_2
 
Resource Report
Resource Website
RRID:Addgene_102313 sgFTCD_2 Homo sapiens Ampicillin PMID:29995852 Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
p35S:TN3-YFPn
 
Resource Report
Resource Website
RRID:Addgene_102407 TN3 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 0
p35S::ARA6/RabF1-YFPc
 
Resource Report
Resource Website
RRID:Addgene_102408 ARA6 Arabidopsis thaliana Ampicillin Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 0
pSIN-PAmCherry-mSNCA-NE
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_102364 PA-mCherry Synthetic Ampicillin PMID:30983487 There is a "NheI" restriction site which we artificially added between PAmCherry and SNCA-NE to facilitate cloning. i.e. 5'---PAmCherry-NheI-SNCA-NE----3' This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/) Backbone Marker:SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.; Backbone Size:7500; Vector Backbone:pSin4-EF2-IRES-Pur; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.