Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:gentamicin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

792 Results - per page

Show More Columns | Download 792 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pEN_TT 3xHA-MKK6-EE
 
Resource Report
Resource Website 		RRID:Addgene_47544 3xHA-MKK6-EE Homo sapiens Gentamicin PMID:23332156 Backbone Marker:Addgene #2752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin S207E, T211E Addgene 2026-10-10 01:53:59 0
pPROBE-GT'
 
Resource Report
Resource Website 		RRID:Addgene_37815 Promotorless gfp reporter gene bacteria Gentamicin PMID:11059491 Please refer to the attached table for a complete list of restriction sites in the MCS. Vector Backbone:pVS1/p15a; Vector Types:; Bacterial Resistance:Gentamicin Addgene 2026-10-10 01:52:36 0
pEN_hU6miR-Luc-A
 
Resource Report
Resource Website 		RRID:Addgene_25756 Luciferase miR-shRNA Gentamicin PMID:16945906 Entry vector with U6-driven Luciferase miR-shRNA Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCCACAGATGTATTAATCAGAGACTTCAGGCGGT Backbone Marker:ATCC 10326362; Backbone Size:4316; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-10-10 01:51:17 0
pEN_hU6miR-G13-L
 
Resource Report
Resource Website 		RRID:Addgene_25758 G alpha 13 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with U6-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-10-10 01:51:17 0
pEN_TTRmiRc2
 
Resource Report
Resource Website 		RRID:Addgene_25754 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT Backbone Marker:ATCC 10326362; Backbone Size:5180; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-10-10 01:51:17 0
pEN_TTGmiRc2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25753 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT Backbone Marker:ATCC 10326362; Backbone Size:5153; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-10-10 01:51:17 3
pEN_TRmiRc2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25750 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE Backbone Marker:ATCC 10326362; Backbone Size:5309; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-10-10 01:51:17 1
pEN_TGmiR_Gb2-K
 
Resource Report
Resource Website 		RRID:Addgene_25766 Gb2 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G beta 2 miR-shRNA (TGCTCATGTATTCCCACGACAA) and co-expressed GFP Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-10-10 01:51:17 0
pEN_TmiR_G12-E
 
Resource Report
Resource Website 		RRID:Addgene_25761 G alpha 12 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT Addgene sequence shows that this plasmid is missing the EcoRI and SpeI sites. Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-10-10 01:51:17 0
pEN_hUmiRc2
 
Resource Report
Resource Website 		RRID:Addgene_25747 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; Human U6 promoter; 27nt U6 leader sequence expressed in transcript; Entry vector backbone; +ccdB in parent; Addgene sequence shows that there is a T missing in U6 promoter sequence. Depositor is aware of the mismatch and it should not affect plasmid function. Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-10-10 01:51:17 0
pOmniBac zz TEV YBBR TRF1
 
Resource Report
Resource Website 		RRID:Addgene_185445 TRF1 Homo sapiens Gentamicin PMID:35077681 Backbone Size:4554; Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Addgene 2026-10-10 02:01:13 0
pPSV39-dddAI
 
Resource Report
Resource Website 		RRID:Addgene_186557 dddAI Burkholderia cenocepacia Gentamicin PMID:35650286 Backbone Size:6041; Vector Backbone:pPSV39-CV; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin Addgene 2026-10-10 02:01:17 0
pMBEC6
 
Resource Report
Resource Website 		RRID:Addgene_187598 nCas9-BEC-UGI; cas6f, gfp Gentamicin PMID:35641501 Backbone Marker:Quanjiang Ji (Addgene plasmid # 113349); Backbone Size:5000; Vector Backbone:pnCas9PA-BEC; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin Addgene 2026-10-10 02:01:18 0
p63_AF043
 
Resource Report
Resource Website 		RRID:Addgene_175878 AF043 cassette Synthetic Gentamicin PMID:33785746 Backbone Size:3000; Vector Backbone:pSEVA631; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin Addgene 2026-10-10 02:01:20 0
pAM5082
 
Resource Report
Resource Website 		RRID:Addgene_85121 PkaiB-KaiC-ECFP Synechoccus elongatus PCC 7942 Gentamicin PMID:25127213 Vector Backbone:PkaiB-kaiC-ecfp expressed from NS2 vector with Gm resistance constructed by seamless assembly.; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin Addgene 2026-10-10 01:59:24 0
C321.∆A.opt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_87359 C321.∆A.opt strain Synthetic Gentamicin PMID:28545477 C321.∆A.opt is a variant of C321.∆A (Addgene Item #48998) engineered to have a faster growth rate, as reported in Kuznetsov, Gleb, et al. "Optimizing complex phenotypes through model-guided multiplex genome engineering." bioRxiv (2016): 086595. This strain has a heat-inducible lambda prophage (42 C) and should be grown at or below 34 C to avoid induction. The original strain C321.∆A (Addgene Item #48998) was reported in Lajoie, Marc J., et al. "Genomically recoded organisms expand biological functions." Science 342.6156 (2013): 357-360. Vector Backbone:Whole genome; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin Addgene 2026-10-10 01:59:42 4
pCRISPR2_+10D
 
Resource Report
Resource Website 		RRID:Addgene_149391 Pseudomonas aeruginosa PA14 CRISPR2 locus Pseudomonas aeruginosa UCBPP-PA14 Gentamicin PMID:34174210 Backbone Size:5220; Vector Backbone:pHERD30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 10bp inserted downstream of the IHFprox site Addgene 2026-10-10 02:01:31 0
pCRISPR2_+10D+7U
 
Resource Report
Resource Website 		RRID:Addgene_149393 Pseudomonas aeruginosa PA14 CRISPR2 locus Pseudomonas aeruginosa UCBPP-PA14 Gentamicin PMID:34174210 Backbone Size:5220; Vector Backbone:pHERD30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 7bp inserted upstream, and 10bp inserted downstream of the IHFprox site Addgene 2026-10-10 02:01:31 0
pCRISPR2_wt
 
Resource Report
Resource Website 		RRID:Addgene_149386 Pseudomonas aeruginosa PA14 CRISPR2 locus Pseudomonas aeruginosa UCBPP-PA14 Gentamicin PMID:34174210 Backbone Size:5220; Vector Backbone:pHERD30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin Addgene 2026-10-10 02:01:31 0
pCRISPR2_IHF_Opt
 
Resource Report
Resource Website 		RRID:Addgene_149395 Pseudomonas aeruginosa PA14 CRISPR2 locus Pseudomonas aeruginosa UCBPP-PA14 Gentamicin PMID:34174210 Backbone Size:5220; Vector Backbone:pHERD30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin IHFprox site is optimized at key positions needed for IHF binding and bending Addgene 2026-10-10 02:01:31 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch