Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: 3xHA-MKK6-EE
Vector Backbone Description: Backbone Marker:Addgene #2752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:23332156
Proper citation: RRID:Addgene_47544 Copy
Species: bacteria
Genetic Insert: Promotorless gfp reporter gene
Vector Backbone Description: Vector Backbone:pVS1/p15a; Vector Types:; Bacterial Resistance:Gentamicin
Defining Citation: PMID:11059491
Comments: Please refer to the attached table for a complete list of restriction sites in the MCS.
Proper citation: RRID:Addgene_37815 Copy
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4316; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven Luciferase miR-shRNA
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCCACAGATGTATTAATCAGAGACTTCAGGCGGT
Proper citation: RRID:Addgene_25756 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G alpha 13 miR-shRNA
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
Proper citation: RRID:Addgene_25758 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5180; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT
Proper citation: RRID:Addgene_25754 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5153; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT
Proper citation: RRID:Addgene_25753 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5309; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE
Proper citation: RRID:Addgene_25750 Copy
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G beta 2 miR-shRNA (TGCTCATGTATTCCCACGACAA) and co-expressed GFP
Proper citation: RRID:Addgene_25766 Copy
Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 12 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
Addgene sequence shows that this plasmid is missing the EcoRI and SpeI sites.
Proper citation: RRID:Addgene_25761 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; Human U6 promoter; 27nt U6 leader sequence expressed in transcript; Entry vector backbone; +ccdB in parent;
Addgene sequence shows that there is a T missing in U6 promoter sequence. Depositor is aware of the mismatch and it should not affect plasmid function.
Proper citation: RRID:Addgene_25747 Copy
Species: Homo sapiens
Genetic Insert: TRF1
Vector Backbone Description: Backbone Size:4554; Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35077681
Proper citation: RRID:Addgene_185445 Copy
Species: Burkholderia cenocepacia
Genetic Insert: dddAI
Vector Backbone Description: Backbone Size:6041; Vector Backbone:pPSV39-CV; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35650286
Proper citation: RRID:Addgene_186557 Copy
Genetic Insert: nCas9-BEC-UGI; cas6f, gfp
Vector Backbone Description: Backbone Marker:Quanjiang Ji (Addgene plasmid # 113349); Backbone Size:5000; Vector Backbone:pnCas9PA-BEC; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35641501
Proper citation: RRID:Addgene_187598 Copy
Species: Synthetic
Genetic Insert: AF043 cassette
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pSEVA631; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33785746
Proper citation: RRID:Addgene_175878 Copy
Species: Synechoccus elongatus PCC 7942
Genetic Insert: PkaiB-KaiC-ECFP
Vector Backbone Description: Vector Backbone:PkaiB-kaiC-ecfp expressed from NS2 vector with Gm resistance constructed by seamless assembly.; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:25127213
Proper citation: RRID:Addgene_85121 Copy
Species: Synthetic
Genetic Insert: C321.∆A.opt strain
Vector Backbone Description: Vector Backbone:Whole genome; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:28545477
Comments: C321.∆A.opt is a variant of C321.∆A (Addgene Item #48998) engineered to have a faster growth rate, as reported in Kuznetsov, Gleb, et al. "Optimizing complex phenotypes through model-guided multiplex genome engineering." bioRxiv (2016): 086595.
This strain has a heat-inducible lambda prophage (42 C) and should be grown at or below 34 C to avoid induction.
The original strain C321.∆A (Addgene Item #48998) was reported in Lajoie, Marc J., et al. "Genomically recoded organisms expand biological functions." Science 342.6156 (2013): 357-360.
Proper citation: RRID:Addgene_87359 Copy
Species: Pseudomonas aeruginosa UCBPP-PA14
Genetic Insert: Pseudomonas aeruginosa PA14 CRISPR2 locus
Vector Backbone Description: Backbone Size:5220; Vector Backbone:pHERD30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34174210
Proper citation: RRID:Addgene_149391 Copy
Species: Pseudomonas aeruginosa UCBPP-PA14
Genetic Insert: Pseudomonas aeruginosa PA14 CRISPR2 locus
Vector Backbone Description: Backbone Size:5220; Vector Backbone:pHERD30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34174210
Proper citation: RRID:Addgene_149393 Copy
Species: Pseudomonas aeruginosa UCBPP-PA14
Genetic Insert: Pseudomonas aeruginosa PA14 CRISPR2 locus
Vector Backbone Description: Backbone Size:5220; Vector Backbone:pHERD30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34174210
Proper citation: RRID:Addgene_149386 Copy
Species: Pseudomonas aeruginosa UCBPP-PA14
Genetic Insert: Pseudomonas aeruginosa PA14 CRISPR2 locus
Vector Backbone Description: Backbone Size:5220; Vector Backbone:pHERD30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34174210
Proper citation: RRID:Addgene_149395 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
