Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 213 showing 4241 ~ 4260 out of 328,630 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_39292

    This resource has 10+ mentions.

http://www.addgene.org/39292

Genetic Insert: KanR
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9717240

Proper citation: RRID:Addgene_39292 Copy   


  • RRID:Addgene_39280

http://www.addgene.org/39280

Species: Schizosaccharomyces pombe
Genetic Insert: nmt1 promoter
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9717240

Proper citation: RRID:Addgene_39280 Copy   


  • RRID:Addgene_39282

http://www.addgene.org/39282

Species: Schizosaccharomyces pombe
Genetic Insert: nmt1 promoter
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9717240
Comments: 7bp deletion (ATATAAA), 2nt mismatch at bp#4267-4268 and 7nt deletion at bp#4269-4275 when compared to EU493333.1. Does not effect function.

Proper citation: RRID:Addgene_39282 Copy   


  • RRID:Addgene_39261

http://www.addgene.org/39261

Species: Mus musculus
Genetic Insert: Kaede
Vector Backbone Description: Vector Backbone:pCS2-Kaede; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19740427

Proper citation: RRID:Addgene_39261 Copy   


  • RRID:Addgene_39407

http://www.addgene.org/39407

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-25-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TCGGCGAGCTGCACG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb

Proper citation: RRID:Addgene_39407 Copy   


  • RRID:Addgene_39406

http://www.addgene.org/39406

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-25-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TCAAGATCCGCCACA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb

Proper citation: RRID:Addgene_39406 Copy   


  • RRID:Addgene_39403

http://www.addgene.org/39403

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-23-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TCGTCCTTGAAGAAG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb

Proper citation: RRID:Addgene_39403 Copy   


  • RRID:Addgene_39405

http://www.addgene.org/39405

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-24-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTGCCGTCCTCCTTG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb

Proper citation: RRID:Addgene_39405 Copy   


  • RRID:Addgene_39368

http://www.addgene.org/39368

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-06-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TGCCACCTACG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.6kb and 5.8kb

Proper citation: RRID:Addgene_39368 Copy   


  • RRID:Addgene_39367

http://www.addgene.org/39367

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-05-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TAGGTGGCATC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.6kb and 5.8kb

Proper citation: RRID:Addgene_39367 Copy   


  • RRID:Addgene_39400

http://www.addgene.org/39400

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-22-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TGGTGCCCATCCTGG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb

Proper citation: RRID:Addgene_39400 Copy   


  • RRID:Addgene_39371

http://www.addgene.org/39371

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-07-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TGCACGCCGTA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.6kb and 5.8kb

Proper citation: RRID:Addgene_39371 Copy   


http://www.addgene.org/39463

Genetic Insert: burs-mCD8-EGFP-T2A-Gal4
Vector Backbone Description: Backbone Size:8491; Vector Backbone:pC-attB; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22209908

Proper citation: RRID:Addgene_39463 Copy   


  • RRID:Addgene_39457

    This resource has 1+ mentions.

http://www.addgene.org/39457

Genetic Insert: mCD8-D2A-Gal4
Vector Backbone Description: Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22209908

Proper citation: RRID:Addgene_39457 Copy   


http://www.addgene.org/39459

Genetic Insert: mCD8-F2A-Gal4
Vector Backbone Description: Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22209908

Proper citation: RRID:Addgene_39459 Copy   


  • RRID:Addgene_39453

http://www.addgene.org/39453

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-48-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTGAAGTCGATGCCCTTCAGC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.6kb and 5.8kb

Proper citation: RRID:Addgene_39453 Copy   


  • RRID:Addgene_39456

http://www.addgene.org/39456

Genetic Insert: mCD8-Gal4
Vector Backbone Description: Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:S2; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22209908

Proper citation: RRID:Addgene_39456 Copy   


http://www.addgene.org/39455

Species: Homo sapiens
Genetic Insert: HA-hTet1CDmu
Vector Backbone Description: Backbone Size:5321; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21496894

Proper citation: RRID:Addgene_39455 Copy   


  • RRID:Addgene_39450

http://www.addgene.org/39450

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-47-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTCATCTGCACCACCGGCAAG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.6kb and 5.8kb

Proper citation: RRID:Addgene_39450 Copy   


  • RRID:Addgene_39446

    This resource has 1+ mentions.

http://www.addgene.org/39446

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-45-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTCAAGTCCGCCATGCCCGA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb

Proper citation: RRID:Addgene_39446 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X