Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pFA6a-GFP(S65T)-kanMX6 Resource Report Resource Website 10+ mentions |
RRID:Addgene_39292 | KanR | Ampicillin | PMID:9717240 | Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:27 | 12 | |||
|
pFA6a-kanMX6-P3nmt1 Resource Report Resource Website |
RRID:Addgene_39280 | nmt1 promoter | Schizosaccharomyces pombe | Ampicillin | PMID:9717240 | Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin | -1163 to +6 of nmt1 locus | 2026-08-15 01:14:26 | 0 | |
|
pFA6a-kanMX6-P81nmt1 Resource Report Resource Website |
RRID:Addgene_39282 | nmt1 promoter | Schizosaccharomyces pombe | Ampicillin | PMID:9717240 | 7bp deletion (ATATAAA), 2nt mismatch at bp#4267-4268 and 7nt deletion at bp#4269-4275 when compared to EU493333.1. Does not effect function. | Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin | -1163 to +6 of nmt1 locus with a 7bp deletion (ATATAAA) ~100bp from 3' end of promoter | 2026-08-15 01:14:26 | 0 |
|
pCAG:Kaede Resource Report Resource Website |
RRID:Addgene_39261 | Kaede | Mus musculus | Ampicillin | PMID:19740427 | Vector Backbone:pCS2-Kaede; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:26 | 0 | ||
|
TAL2049 Resource Report Resource Website |
RRID:Addgene_39407 | eGFP-TALEN-25-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TCGGCGAGCTGCACG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2048 Resource Report Resource Website |
RRID:Addgene_39406 | eGFP-TALEN-25-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TCAAGATCCGCCACA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2045 Resource Report Resource Website |
RRID:Addgene_39403 | eGFP-TALEN-23-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TCGTCCTTGAAGAAG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2047 Resource Report Resource Website |
RRID:Addgene_39405 | eGFP-TALEN-24-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TTGCCGTCCTCCTTG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2010 Resource Report Resource Website |
RRID:Addgene_39368 | eGFP-TALEN-06-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TGCCACCTACG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.6kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:27 | 0 | |
|
TAL2009 Resource Report Resource Website |
RRID:Addgene_39367 | eGFP-TALEN-05-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TAGGTGGCATC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.6kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:27 | 0 | |
|
TAL2042 Resource Report Resource Website |
RRID:Addgene_39400 | eGFP-TALEN-22-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TGGTGCCCATCCTGG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2013 Resource Report Resource Website |
RRID:Addgene_39371 | eGFP-TALEN-07-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TGCACGCCGTA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.6kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:27 | 0 | |
|
pC-attB-burs-mCD8-EGFP-T2A-Gal4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39463 | burs-mCD8-EGFP-T2A-Gal4 | Ampicillin | PMID:22209908 | Backbone Size:8491; Vector Backbone:pC-attB; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 2 | |||
|
pPac-PL-mCD8-D2A-Gal4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39457 | mCD8-D2A-Gal4 | Ampicillin | PMID:22209908 | Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 1 | |||
|
pPac-PL-mCD8-F2A-Gal4 Resource Report Resource Website |
RRID:Addgene_39459 | mCD8-F2A-Gal4 | Ampicillin | PMID:22209908 | Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |||
|
TAL2085 Resource Report Resource Website |
RRID:Addgene_39453 | eGFP-TALEN-48-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TTGAAGTCGATGCCCTTCAGC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.6kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
pPac-PL-mCD8-Gal4 Resource Report Resource Website |
RRID:Addgene_39456 | mCD8-Gal4 | Ampicillin | PMID:22209908 | Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:S2; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |||
|
pAAV-EF1a-HA-hTet1CDmu-WPRE-PolyA Resource Report Resource Website 1+ mentions |
RRID:Addgene_39455 | HA-hTet1CDmu | Homo sapiens | Ampicillin | PMID:21496894 | Backbone Size:5321; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | aa1418–2136 with mutations H1672 to Y, 1674D to A | 2026-08-15 01:14:28 | 4 | |
|
TAL2080 Resource Report Resource Website |
RRID:Addgene_39450 | eGFP-TALEN-47-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TTCATCTGCACCACCGGCAAG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.6kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2076 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39446 | eGFP-TALEN-45-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TTCAAGTCCGCCATGCCCGA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.