Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: GSK3 beta S9A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7980435
Comments: S2A in the sequence does not affect function, used to introduce restriction enzyme site
Proper citation: RRID:Addgene_14754 Copy
Species: N. pharaonis
Genetic Insert: Mammalian codon-optimized halorhodopsin, from Natronomas pharaonis (N. pharaonis), fused with GFP at the C-terminus
Vector Backbone Description: Backbone Marker:Pavel Osten; Backbone Size:9500; Vector Backbone:FCK(1.3)GW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17375185
Comments: PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS
REAGENT AND FURTHER REAGENTS IN THIS LINE.
Proper citation: RRID:Addgene_14750 Copy
Species: Homo sapiens
Genetic Insert: N-ras
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11305105
Proper citation: RRID:Addgene_14725 Copy
Species: Homo sapiens
Genetic Insert: H-ras
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11305105
Comments: GTPase deficient (dominant active) mutant: GAP insensitive, increased GDP/GTP exchange, and chronically GTP bound; transforming.
Proper citation: RRID:Addgene_14720 Copy
Vector Backbone Description: Backbone Size:6794; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1995. Fire Lab Miniprep Number pPD93.97, Ligation number NONE.
Proper citation: RRID:Addgene_1476 Copy
Vector Backbone Description: Backbone Size:4699; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1995. Fire Lab Miniprep Number pPD94.81, Ligation number NONE.
Proper citation: RRID:Addgene_1477 Copy
Species: Homo sapiens
Genetic Insert: R-ras
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11305105
Proper citation: RRID:Addgene_14730 Copy
Species: Rattus norvegicus
Genetic Insert: MRF4
Vector Backbone Description: Backbone Size:5300; Vector Backbone:EMSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10733231
Proper citation: RRID:Addgene_14713 Copy
Species: Homo sapiens
Genetic Insert: DGCR8 shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: shRNA sequence: TGGGGTGAGA GTGCTGATAA TTCAAGAGAT TATCAGCACT CTCACCCCTT TTTTC
Proper citation: RRID:Addgene_14769 Copy
Species: Homo sapiens
Genetic Insert: Drosha shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: shRNA sequence: TGAAGCTCGA TGAAGATTTA TTCAAGAGAT AAATCTTCAT CGAGCTTCTT TTTTC
Proper citation: RRID:Addgene_14766 Copy
Species: Homo sapiens
Genetic Insert: Drosha shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: shRNA sequence: TGAAGCTCTT TGGTGAATAA TTCAAGAGAT TATTCACCAA AGAGCTTCTT TTTTC
Proper citation: RRID:Addgene_14767 Copy
Genetic Insert: EGFPd2
Vector Backbone Description: Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17209010
Proper citation: RRID:Addgene_14760 Copy
Species: Mus musculus
Genetic Insert: Hmga2 wt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Proper citation: RRID:Addgene_14789 Copy
Species: Mus musculus
Genetic Insert: let-7g
Vector Backbone Description: Backbone Marker:BD Biosciences; Backbone Size:6500; Vector Backbone:MSCV-neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: miRNA of the following mature sequence, with approximately 500 basepairs of flanking sequence, were cloned into MSCV-neo: let-7g: 5’-UGAGG UAGUA GUUUG UACAG U-3’.
Proper citation: RRID:Addgene_14784 Copy
Species: Mus musculus
Genetic Insert: Luc-wt
Vector Backbone Description: Backbone Marker:Available from Addgene (#12179); Backbone Size:4000; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.
Proper citation: RRID:Addgene_14785 Copy
Species: Homo sapiens
Genetic Insert: Smad3 NL
Vector Backbone Description: Backbone Marker:Genentech; Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9094310
Comments: See Author's map for cloning details.
Proper citation: RRID:Addgene_14828 Copy
Species: Homo sapiens
Genetic Insert: Retinoblastoma Binding Protein 2
Vector Backbone Description: Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17320163
Comments: The plasmid encodes isoform 2.
Proper citation: RRID:Addgene_14799 Copy
Species: Homo sapiens
Genetic Insert: Smad3 C
Vector Backbone Description: Backbone Marker:Genentech; Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9094310
Comments: See Author's map for cloning details.
Proper citation: RRID:Addgene_14830 Copy
Species: Rattus norvegicus
Genetic Insert: TGF beta type I receptor
Vector Backbone Description: Backbone Marker:Genentech; Backbone Size:4700; Vector Backbone:pRK5 modified with flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8662796
Comments: See Author's map for more information.
A 9bp linker was added directly upstream of the GS domain. The linker encodes the amino acids GSM. The additional sequence does not affect plasmid function.
Proper citation: RRID:Addgene_14831 Copy
Species: Mus musculus
Genetic Insert: Hmga2 m7
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Full sequence of wild-type plasmid available at Addgene plasmid #14789.
Proper citation: RRID:Addgene_14792 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
