Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
ET8-GPIba-6His Resource Report Resource Website |
RRID:Addgene_102878 | Human platelet membrane protein GPIb alpha 1-290aa | Homo sapiens | Kanamycin | PMID:28831047 | Backbone Size:5374; Vector Backbone:ET8; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:00:27 | 0 | ||
|
STAGR_SAMScaffold_hU6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_102843 | gRNAScaffold_hU6promoter | Kanamycin | PMID:29702666 | Backbone Size:3250; Vector Backbone:Human gRNA Expression Vector / PCR Template for STAgR; Vector Types:as PCR template; Bacterial Resistance:Kanamycin | 2026-08-15 01:00:27 | 1 | |||
|
STAGR_gRNAScaffold_mU6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_102844 | STAgR Insert gRNAScaffold_mU6 | Kanamycin | PMID:29702666 | Backbone Marker:Stricker Lab; Vector Backbone:PCR Template for STAgR Reactions; Vector Types:PCR Template for STAgR Inserts; Bacterial Resistance:Kanamycin | 2026-08-15 01:00:26 | 2 | |||
|
STAGR_SAMScaffold_mU6 Resource Report Resource Website |
RRID:Addgene_102845 | STAgR Insert SAM_mU6 | Kanamycin | PMID:29702666 | Backbone Marker:Stricker Lab; Vector Backbone:PCR Template for STAgR Reactions; Vector Types:PCR Template for STAgR Inserts; Bacterial Resistance:Kanamycin | 2026-08-15 01:00:26 | 0 | |||
|
STAGR_gRNAScaffold_h7SK Resource Report Resource Website |
RRID:Addgene_102842 | gRNAScaffold_h7SKpromoter | Kanamycin | PMID:29702666 | Vector Backbone:pcDNA1; Vector Types:as PCR template; Bacterial Resistance:Kanamycin | 2026-08-15 01:00:26 | 0 | |||
|
pCMV-5U-Venus-PSD-95-3U Resource Report Resource Website 1+ mentions |
RRID:Addgene_102949 | PSD-95 | Mus musculus | Kanamycin | PMID:25948262 | Backbone Size:4141; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:00:27 | 3 | ||
|
pSC101_TIMER Resource Report Resource Website 1+ mentions |
RRID:Addgene_103057 | TIMER-bac | Synthetic | Kanamycin | PMID:25126781 | TIMER-bac was generated by exchanging TCC coding for serine 197 to ACC coding for threonine in DsRed.T3_S4T (Sörensen et al., 2003). PybaJ-Timer-bac was cloned into pUA66 with a pSC101 replicon, conferring kanamycin resistance. | Backbone Size:9262; Vector Backbone:pSC101; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | mutations: S4T and S179T | 2026-08-15 01:00:29 | 4 |
|
pI1-MTU-DO-HIS Resource Report Resource Website |
RRID:Addgene_160142 | Kanamycin | PMID:33176787 | Backbone Marker:Partially Addgene; Backbone Size:4904; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125030 and 125063); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:39 | 0 | ||||
|
pI3-MTU-DO-LEU Resource Report Resource Website |
RRID:Addgene_160176 | Kanamycin | PMID:33176787 | Backbone Marker:Partially Addgene; Backbone Size:5640; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125032 and 125065); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:36 | 0 | ||||
|
35 pCOLI_K_HA Resource Report Resource Website |
RRID:Addgene_160178 | Kanamycin | PMID:32955754 | Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:39 | 0 | ||||
|
36 pCOLI_K_Myc Resource Report Resource Website |
RRID:Addgene_160179 | Kanamycin | PMID:32955754 | Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:36 | 0 | ||||
|
pI4-MTU-DO-G418 Resource Report Resource Website |
RRID:Addgene_160215 | Kanamycin | PMID:33176787 | Backbone Marker:Partially Addgene; Backbone Size:5129; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125033 and 125066); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:37 | 0 | ||||
|
pI3-MTU-DO-HPH Resource Report Resource Website |
RRID:Addgene_160207 | Kanamycin | PMID:33176787 | Backbone Marker:Partially Addgene; Backbone Size:5336; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125032 and 125065); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:36 | 0 | ||||
|
pXZ13lacZalphaKanR Resource Report Resource Website |
RRID:Addgene_160230 | Kanamycin | Modification of pXZ13lacZalpha construct to exchange Kanamycin gene for original Ampicillin gene. This improves upon the cloning efficiency of the original pXZ13 vector (reference below) in three ways: 1) The distance between the Esp3I sites is increased to increase cutting efficiency, 2) lacZalpha complementation is introduced to allow for blue/white screening of recombinants, and 3) Kanamycin selection removes 3 of the 4 original parental plasmids from forming colonies in the final plating. Original vector reference: Zhang X, Koolhaas WH, Schnorrer F. A Versatile Two-Step CRISPR- and RMCE-Based Strategy for Efficient Genome Engineering in Drosophila. G3 (Bethesda). 2014 Oct 15;4(12):2409-18 | Backbone Marker:Dianne Duncan; Backbone Size:1961; Vector Backbone:pXZ13lacZalpha; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:37 | 0 | ||||
|
42 pCOLI_K_C_HIS Resource Report Resource Website |
RRID:Addgene_160185 | Kanamycin | PMID:32955754 | Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:36 | 0 | ||||
|
pENTR1A_mmFbxw7_R505C (closed) Resource Report Resource Website |
RRID:Addgene_160103 | Fbxw7 alpha R505C | Mus musculus | Kanamycin | PMID:32371478 | Vector Backbone:pENTR1A backbone; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Kanamycin | R505C | 2026-08-15 01:08:36 | 0 | |
|
pDONR221_mmIrf1 (closed) Resource Report Resource Website |
RRID:Addgene_160097 | Irf1 | Mus musculus | Kanamycin | PMID:32371478 | Backbone Size:3811; Vector Backbone:pDONR221 backbone; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:35 | 0 | ||
|
pENTR1A_Mavs (open) Resource Report Resource Website |
RRID:Addgene_160099 | Mavs | Mus musculus | Kanamycin | PMID:32371478 | Vector Backbone:pENTR1A backbone; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:35 | 0 | ||
|
pT7-SpCas9_sgRNA-site1 (RTW443) Resource Report Resource Website 1+ mentions |
RRID:Addgene_160136 | SpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG) | Synthetic | Kanamycin | PMID:33547443 | Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:36 | 2 | ||
|
pT7-SpCas9_sgRNA-site2 (RTW448) Resource Report Resource Website 1+ mentions |
RRID:Addgene_160137 | SpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT) | Synthetic | Kanamycin | PMID:33547443 | Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:39 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
