Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
PB_iNEUROD1_P2A_GFP_Puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_168803 NEUROD1 Homo sapiens Ampicillin PMID:34559998 Backbone Size:7527; Vector Backbone:PB-TRE; Vector Types:Mammalian Expression, Synthetic Biology, PiggyBac; Bacterial Resistance:Ampicillin 2026-08-15 01:09:55 3
pTRE2-Bla(HA–RILP)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102425 Rab interacting lysosomal protein Homo sapiens Ampicillin PMID:27791088 Backbone Size:4858; Vector Backbone:pTre2-Bla; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 1
pPB-CAG-rtTA-IRES-Hygro
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_102423 tetracyclin-transactivator (rtTA) Ampicillin PMID:28504700 IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers: Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 10
pLentiCRISPR sgHAL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102315 sgHAL Homo sapiens Ampicillin PMID:29995852 Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 2
scFv-sfGFP-DNMT3A1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102278 DNMT3A1 Homo sapiens Ampicillin PMID:28923089 Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 3
pSIN-PAmCherry-mSNCA-NE
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102364 PA-mCherry Synthetic Ampicillin PMID:30983487 There is a "NheI" restriction site which we artificially added between PAmCherry and SNCA-NE to facilitate cloning. i.e. 5'---PAmCherry-NheI-SNCA-NE----3' This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/) Backbone Marker:SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.; Backbone Size:7500; Vector Backbone:pSin4-EF2-IRES-Pur; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 1
pSIN-PAmCherry-KFERQ-NE
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102365 PA-mCherry Synthetic Ampicillin PMID:30983487 "KFERQ" is the consensus peptide sequence found in various native proteins for mediating degradation via Chaperone-Mediated Autophagy (CMA) There is a "NheI" restriction site which we artificially added between PAmCherry and KFERQ-NE to facilitate cloning. i.e. 5'---PAmCherry-NheI-KFERQ-NE----3' This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/) Backbone Marker:SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.; Backbone Size:7500; Vector Backbone:pSin4-EF2-IRES-Pur; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 8
pVC-Ds-E1b:eGFP-Ds
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102417 E1b:eGFP Danio rerio Ampicillin PMID:37367831 A. Emelyanov and S. Parinov. Mifepristone-inducible LexPR system to drive and control gene expression in transgenic zebrafish. Developmental Biology, 320(1):113– 121, 2008. ISSN 00121606. doi: 10.1016/j.ydbio.2008.04.042. A. Emelyanov, Y. Gao, N. I. Naqvi, and S. Parinov. Trans-kingdom transposition of the maize Dissociation element. Genetics, 174(3):1095–1104, 2006. ISSN 00166731. doi: 10.1534/genetics.106.061184. Please visit https://www.biorxiv.org/content/10.1101/450684v2 for bioRxiv preprint. Backbone Size:3873; Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 1
pLenti TurboRFP BlastR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102343 TurboRFP Synthetic Ampicillin PMID:30263951 Backbone Marker:Goodrum Lab, University of Arizona; Backbone Size:7353; Vector Backbone:pCIG3 #78264; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 1
Pink Flamindo
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_102356 Pink Flamindo Ampicillin PMID:28779099 Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:23 18
pSS1 (hLPL-FLAG)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102447 Lipoprotein lipase Homo sapiens Ampicillin PMID:25809481 Backbone Size:5000; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 1
pMi(3xP3-EGFP)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102540 Minos transpoable element with 3xP3-EGFP marker Ampicillin PMID:15238525 Vector Backbone:pBluescript; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 1
pm-iATPSnFR1.0
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102548 iATPSnFR1.0 Ampicillin PMID:30755613 Vector Backbone:pdisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 3
pm-iATPSnFR1.1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102549 iATPSnFR1.1 Ampicillin PMID:30755613 Vector Backbone:pdisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 4
cyto-Ruby3-iATPSnFR1.0
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102551 Ruby3-iATPSnFR1.0 Ampicillin PMID:30755613 Vector Backbone:pdisplay modified; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 5
GfaABC1D-cyto-Ruby3-iATPSnFR1.0
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102554 mRuby3-iATPSnFR1.0 Ampicillin PMID:30755613 Vector Backbone:pZAC; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 1
Synapsin-cyto-iATPSnFR1.0
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102556 iATPSnFR1.0 Ampicillin PMID:30755613 Vector Backbone:psynapsin; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 2
pBlueSKMimRNA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102535 Minos transposase mRNA Minos transposon Ampicillin PMID:15238525 Vector Backbone:pBluescript SK II+; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 2
pcDNA3.1-hPTGS2-2flag
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102498 PTGS2 Homo sapiens Ampicillin PMID:28346420 Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:24 2
pTRIP-SFFV-mtagBFP-2A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102585 Ampicillin PMID:28484079 Vector Backbone:pTRIP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:00:25 6

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch