Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 218 showing 4341 ~ 4360 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_168803

    This resource has 1+ mentions.

http://www.addgene.org/168803

Species: Homo sapiens
Genetic Insert: NEUROD1
Vector Backbone Description: Backbone Size:7527; Vector Backbone:PB-TRE; Vector Types:Mammalian Expression, Synthetic Biology, PiggyBac; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34559998

Proper citation: RRID:Addgene_168803 Copy   


  • RRID:Addgene_102425

    This resource has 1+ mentions.

http://www.addgene.org/102425

Species: Homo sapiens
Genetic Insert: Rab interacting lysosomal protein
Vector Backbone Description: Backbone Size:4858; Vector Backbone:pTre2-Bla; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27791088

Proper citation: RRID:Addgene_102425 Copy   


  • RRID:Addgene_102423

    This resource has 10+ mentions.

http://www.addgene.org/102423

Genetic Insert: tetracyclin-transactivator (rtTA)
Vector Backbone Description: Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28504700
Comments: IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers: Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG

Proper citation: RRID:Addgene_102423 Copy   


  • RRID:Addgene_102315

    This resource has 1+ mentions.

http://www.addgene.org/102315

Species: Homo sapiens
Genetic Insert: sgHAL
Vector Backbone Description: Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995852

Proper citation: RRID:Addgene_102315 Copy   


  • RRID:Addgene_102278

    This resource has 1+ mentions.

http://www.addgene.org/102278

Species: Homo sapiens
Genetic Insert: DNMT3A1
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28923089

Proper citation: RRID:Addgene_102278 Copy   


  • RRID:Addgene_102364

    This resource has 1+ mentions.

http://www.addgene.org/102364

Species: Synthetic
Genetic Insert: PA-mCherry
Vector Backbone Description: Backbone Marker:SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.; Backbone Size:7500; Vector Backbone:pSin4-EF2-IRES-Pur; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30983487
Comments: There is a "NheI" restriction site which we artificially added between PAmCherry and SNCA-NE to facilitate cloning. i.e. 5'---PAmCherry-NheI-SNCA-NE----3' This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/)

Proper citation: RRID:Addgene_102364 Copy   


  • RRID:Addgene_102365

    This resource has 1+ mentions.

http://www.addgene.org/102365

Species: Synthetic
Genetic Insert: PA-mCherry
Vector Backbone Description: Backbone Marker:SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.; Backbone Size:7500; Vector Backbone:pSin4-EF2-IRES-Pur; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30983487
Comments: "KFERQ" is the consensus peptide sequence found in various native proteins for mediating degradation via Chaperone-Mediated Autophagy (CMA) There is a "NheI" restriction site which we artificially added between PAmCherry and KFERQ-NE to facilitate cloning. i.e. 5'---PAmCherry-NheI-KFERQ-NE----3' This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/)

Proper citation: RRID:Addgene_102365 Copy   


  • RRID:Addgene_102417

    This resource has 1+ mentions.

http://www.addgene.org/102417

Species: Danio rerio
Genetic Insert: E1b:eGFP
Vector Backbone Description: Backbone Size:3873; Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37367831
Comments: A. Emelyanov and S. Parinov. Mifepristone-inducible LexPR system to drive and control gene expression in transgenic zebrafish. Developmental Biology, 320(1):113– 121, 2008. ISSN 00121606. doi: 10.1016/j.ydbio.2008.04.042. A. Emelyanov, Y. Gao, N. I. Naqvi, and S. Parinov. Trans-kingdom transposition of the maize Dissociation element. Genetics, 174(3):1095–1104, 2006. ISSN 00166731. doi: 10.1534/genetics.106.061184. Please visit https://www.biorxiv.org/content/10.1101/450684v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_102417 Copy   


  • RRID:Addgene_102343

    This resource has 1+ mentions.

http://www.addgene.org/102343

Species: Synthetic
Genetic Insert: TurboRFP
Vector Backbone Description: Backbone Marker:Goodrum Lab, University of Arizona; Backbone Size:7353; Vector Backbone:pCIG3 #78264; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30263951

Proper citation: RRID:Addgene_102343 Copy   


  • RRID:Addgene_102356

    This resource has 10+ mentions.

http://www.addgene.org/102356

Genetic Insert: Pink Flamindo
Vector Backbone Description: Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28779099

Proper citation: RRID:Addgene_102356 Copy   


  • RRID:Addgene_102447

    This resource has 1+ mentions.

http://www.addgene.org/102447

Species: Homo sapiens
Genetic Insert: Lipoprotein lipase
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25809481

Proper citation: RRID:Addgene_102447 Copy   


  • RRID:Addgene_102540

    This resource has 1+ mentions.

http://www.addgene.org/102540

Genetic Insert: Minos transpoable element with 3xP3-EGFP marker
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15238525

Proper citation: RRID:Addgene_102540 Copy   


  • RRID:Addgene_102548

    This resource has 1+ mentions.

http://www.addgene.org/102548

Genetic Insert: iATPSnFR1.0
Vector Backbone Description: Vector Backbone:pdisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30755613

Proper citation: RRID:Addgene_102548 Copy   


  • RRID:Addgene_102549

    This resource has 1+ mentions.

http://www.addgene.org/102549

Genetic Insert: iATPSnFR1.1
Vector Backbone Description: Vector Backbone:pdisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30755613

Proper citation: RRID:Addgene_102549 Copy   


  • RRID:Addgene_102551

    This resource has 1+ mentions.

http://www.addgene.org/102551

Genetic Insert: Ruby3-iATPSnFR1.0
Vector Backbone Description: Vector Backbone:pdisplay modified; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30755613

Proper citation: RRID:Addgene_102551 Copy   


http://www.addgene.org/102554

Genetic Insert: mRuby3-iATPSnFR1.0
Vector Backbone Description: Vector Backbone:pZAC; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30755613

Proper citation: RRID:Addgene_102554 Copy   


  • RRID:Addgene_102556

    This resource has 1+ mentions.

http://www.addgene.org/102556

Genetic Insert: iATPSnFR1.0
Vector Backbone Description: Vector Backbone:psynapsin; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30755613

Proper citation: RRID:Addgene_102556 Copy   


  • RRID:Addgene_102535

    This resource has 1+ mentions.

http://www.addgene.org/102535

Species: Minos transposon
Genetic Insert: Minos transposase mRNA
Vector Backbone Description: Vector Backbone:pBluescript SK II+; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15238525

Proper citation: RRID:Addgene_102535 Copy   


  • RRID:Addgene_102498

    This resource has 1+ mentions.

http://www.addgene.org/102498

Species: Homo sapiens
Genetic Insert: PTGS2
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28346420

Proper citation: RRID:Addgene_102498 Copy   


  • RRID:Addgene_102585

    This resource has 1+ mentions.

http://www.addgene.org/102585

Vector Backbone Description: Vector Backbone:pTRIP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28484079

Proper citation: RRID:Addgene_102585 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X