Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 22 showing 421 ~ 440 out of 12,957 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_60667

http://www.addgene.org/60667

Species: Mus musculus
Genetic Insert: Mycn
Vector Backbone Description: Backbone Marker:Thomson lab; Backbone Size:4182; Vector Backbone:pBTO-Dest; Vector Types:Mammalian Expression, PiggyBac; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25458896

Proper citation: RRID:Addgene_60667 Copy   


  • RRID:Addgene_60666

http://www.addgene.org/60666

Species: Mus musculus
Genetic Insert: Lmo2
Vector Backbone Description: Backbone Marker:Thomson lab; Backbone Size:4179; Vector Backbone:pBTO-Dest; Vector Types:Mammalian Expression, PiggyBac; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25458896

Proper citation: RRID:Addgene_60666 Copy   


http://www.addgene.org/60661

Species: Mus musculus
Genetic Insert: FLEX- Kir2.1-T2A-tdTomato
Vector Backbone Description: Backbone Size:5640; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25043046

Proper citation: RRID:Addgene_60661 Copy   


  • RRID:Addgene_60670

http://www.addgene.org/60670

Species: Mus musculus
Genetic Insert: Tal1
Vector Backbone Description: Backbone Marker:Thomson lab; Backbone Size:4179; Vector Backbone:pBTO-Dest; Vector Types:Mammalian Expression, PiggyBac; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25458896

Proper citation: RRID:Addgene_60670 Copy   


http://www.addgene.org/60624

Species: Mus musculus
Genetic Insert: WT mouse MyoD
Vector Backbone Description: Backbone Size:10000; Vector Backbone:pRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25494287

Proper citation: RRID:Addgene_60624 Copy   


  • RRID:Addgene_60858

    This resource has 1+ mentions.

http://www.addgene.org/60858

Species: Mus musculus
Genetic Insert: CTIP2 isoform b
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:7673; Vector Backbone:N174; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25374357

Proper citation: RRID:Addgene_60858 Copy   


  • RRID:Addgene_60857

    This resource has 10+ mentions.

http://www.addgene.org/60857

Species: Mus musculus
Genetic Insert: miR-9/9*-miR-124-BCLxL
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:10335; Vector Backbone:pTLemiR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25374357

Proper citation: RRID:Addgene_60857 Copy   


  • RRID:Addgene_60939

    This resource has 10+ mentions.

http://www.addgene.org/60939

Species: Mus musculus
Genetic Insert: Ten-Eleven Translocation 2
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3*; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24412366
Comments: *modified pcDNA3 vector with a beta globulin intron inserted. This insertion can help stabilize the transcripts and is particularly useful for the expression of large genes, such as p300 and Tet proteins

Proper citation: RRID:Addgene_60939 Copy   


  • RRID:Addgene_60940

    This resource has 1+ mentions.

http://www.addgene.org/60940

Species: Mus musculus
Genetic Insert: Ten-Eleven Translocation 3
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pcDNA-flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24412366

Proper citation: RRID:Addgene_60940 Copy   


  • RRID:Addgene_61086

http://www.addgene.org/61086

Species: Mus musculus
Genetic Insert: smallest constitutive BIN1excluding exon 7, 11, 13-17
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24836577

Proper citation: RRID:Addgene_61086 Copy   


  • RRID:Addgene_61093

http://www.addgene.org/61093

Species: Mus musculus
Genetic Insert: Mag genomic sequence
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23704325

Proper citation: RRID:Addgene_61093 Copy   


  • RRID:Addgene_61090

http://www.addgene.org/61090

Species: Mus musculus
Genetic Insert: hnRNP A1
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pHMTC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23704325

Proper citation: RRID:Addgene_61090 Copy   


  • RRID:Addgene_61096

http://www.addgene.org/61096

Species: Mus musculus
Genetic Insert: mouse BIN1 with exon 17, excluding exon 7, 11, 13-16
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24836577

Proper citation: RRID:Addgene_61096 Copy   


http://www.addgene.org/61292

Species: Mus musculus
Genetic Insert: IL-6 promoter
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12626566
Comments: Contains point mutations in both AP-1 and C/EBP binding sites. See Table 1 of associated publication for more details. Full sequence and map is available for wild-type vector pmIL-6 FL (Plasmid #61290)

Proper citation: RRID:Addgene_61292 Copy   


http://www.addgene.org/61235

Species: Mus musculus
Genetic Insert: Dixdc1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806

Proper citation: RRID:Addgene_61235 Copy   


http://www.addgene.org/61233

Species: Mus musculus
Genetic Insert: Dixdc1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pLentiX2-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25042806

Proper citation: RRID:Addgene_61233 Copy   


http://www.addgene.org/61232

Species: Mus musculus
Genetic Insert: Dixdc1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pLentiX2-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25042806

Proper citation: RRID:Addgene_61232 Copy   


  • RRID:Addgene_61286

    This resource has 1+ mentions.

http://www.addgene.org/61286

Species: Mus musculus
Genetic Insert: IL-6 promoter
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12626566

Proper citation: RRID:Addgene_61286 Copy   


http://www.addgene.org/61514

Species: Mus musculus
Genetic Insert: gccgctcccggatctcctgc
Vector Backbone Description: Vector Backbone:px335; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25569111

Proper citation: RRID:Addgene_61514 Copy   


http://www.addgene.org/61516

Species: Mus musculus
Genetic Insert: Mettl3
Vector Backbone Description: Vector Backbone:pBRPy; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25569111

Proper citation: RRID:Addgene_61516 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X