Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: SARS-CoV-2
Genetic Insert: spike G145
Vector Backbone Description: Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40295734
Proper citation: RRID:Addgene_231918 Copy
Species: Homo sapiens
Genetic Insert: mono-hIL10-R5A11M-rens-3GS-IL10Ra
Vector Backbone Description: Vector Backbone:CMVTO-FlpIn; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39814991
Proper citation: RRID:Addgene_231191 Copy
Species: Homo sapiens
Genetic Insert: mono-hIL10 (R5A11M)-rens
Vector Backbone Description: Vector Backbone:CMVTO-FlpIn; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39814991
Proper citation: RRID:Addgene_231196 Copy
Vector Backbone Description: Backbone Size:3945; Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:39885279
Comments: Please visit https://doi.org/10.1101/2024.07.23.604302 for bioRxiv preprint.
Proper citation: RRID:Addgene_222406 Copy
Species: Homo sapiens
Genetic Insert: Renin-ECL-CD4-tevs-RXR6.2
Vector Backbone Description: Vector Backbone:CMVTO-FlpIn; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39814991
Proper citation: RRID:Addgene_231199 Copy
Species: Mus musculus
Genetic Insert: TOP6BL
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pCDNA3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39605552
Comments: Please visit https://doi.org/10.1101/2024.11.20.624382 for bioRxiv preprint.
Proper citation: RRID:Addgene_231755 Copy
Species: Mus musculus
Genetic Insert: SPO11
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pCDNA3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39605552
Comments: Please visit https://doi.org/10.1101/2024.11.20.624382 for bioRxiv preprint.
Proper citation: RRID:Addgene_231754 Copy
Species: Homo sapiens
Genetic Insert: hIL2-rens-del.2
Vector Backbone Description: Vector Backbone:CMVTO-FlpIn; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39814991
Proper citation: RRID:Addgene_231228 Copy
Species: Discosoma spp
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Addgene ; Backbone Size:2800; Vector Backbone:pLp_3050sNuc; Vector Types:Bacterial Expression; Bacterial Resistance:Erythromycin
Defining Citation: PMID:38326819
Proper citation: RRID:Addgene_229145 Copy
Species: Synthetic
Genetic Insert: FIRE1 SENSOR
Vector Backbone Description: Vector Backbone:nonspecific; Vector Types:Mammalian Expression, Synthetic Biology, Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39824193
Proper citation: RRID:Addgene_228697 Copy
Species: Synthetic
Genetic Insert: FIRE1 CONTROL
Vector Backbone Description: Vector Backbone:nonspecific; Vector Types:Mammalian Expression, Synthetic Biology, Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39824193
Proper citation: RRID:Addgene_228698 Copy
Species: Homo sapiens
Genetic Insert: SumIL2-rens-2GS-IL2Rb
Vector Backbone Description: Vector Backbone:CMVTO-FlpIn; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39814991
Proper citation: RRID:Addgene_231222 Copy
Species: Homo sapiens
Genetic Insert: hIL10dimer-rens-IL10Ra
Vector Backbone Description: Vector Backbone:CMVTO-FlpIn; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39814991
Proper citation: RRID:Addgene_231188 Copy
Species: Homo sapiens
Genetic Insert: SumIL2-3GS-rens-IL2Rb
Vector Backbone Description: Vector Backbone:CMVTO-FlpIn; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39814991
Proper citation: RRID:Addgene_231220 Copy
Species: Homo sapiens
Genetic Insert: Leucine-rich repeat kinase 2
Vector Backbone Description: Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39554022
Proper citation: RRID:Addgene_228879 Copy
Species: SARS-CoV
Genetic Insert: spike all5KO
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40295734
Proper citation: RRID:Addgene_231921 Copy
Species: Homo sapiens
Genetic Insert: PLAG1
Vector Backbone Description: Backbone Marker:plasmid 44012; Vector Backbone:pInducer20; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_231081 Copy
Species: Homo sapiens
Genetic Insert: shRNA for hCavin1
Vector Backbone Description: Backbone Size:7568; Vector Backbone:pLL5.0; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37672337
Comments: hCAVIN1 shRNA: TCACCTTCCACGTCAAGAAGATCCGCGAGGTTCAAGAGACCTCGCGGATCTTCTTGACGTGGAAGGTGTTTTTTC
Proper citation: RRID:Addgene_229690 Copy
Species: Homo sapiens
Genetic Insert: SEC24C
Vector Backbone Description: Backbone Size:7594; Vector Backbone:pMVP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39933900
Comments: SEC24C cDNA synthesized by TWIST Bioscience; closed, PAM mutation (silent mutations of G67 (GGG>GGA) and A115 (GCC>GCA)) and therefore resistant to sgSEC24C #1 (AAGAGCCCCACCTTCCTCGG) and #2 (CTGTGGGCAACCAGCCACCT))
Proper citation: RRID:Addgene_231559 Copy
Species: Synthetic
Genetic Insert: iCre(R297T)
Vector Backbone Description: Vector Backbone:rAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403729
Comments: Allen Institute plasmid alias: CN3980
Proper citation: RRID:Addgene_229918 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
