Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
HA-MBP-TEVpCS-ADGRG7 CTFdeltaTA-FLAG Resource Report Resource Website |
RRID:Addgene_217738 | ADGRG7 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-421 | 2026-08-15 01:29:26 | 0 |
|
HA-MBP-TEVpCS-ADGRL1 CTFdeltaTA-FLAG Resource Report Resource Website |
RRID:Addgene_217739 | ADGRL1 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-844 | 2026-08-15 01:29:26 | 0 |
|
HA-MBP-TEVpCS-ADGRF3 CTF-FLAG Resource Report Resource Website |
RRID:Addgene_217696 | ADGRF3 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-752 | 2026-08-15 01:29:27 | 0 |
|
HA-MBP-TEVpCS-ADGRE5 CTF-FLAG Resource Report Resource Website |
RRID:Addgene_217693 | ADGRE5 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-530 | 2026-08-15 01:29:27 | 0 |
|
HA-MBP-TEVpCS-ADGRF1 CTF-FLAG Resource Report Resource Website |
RRID:Addgene_217694 | ADGRF1 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-566 | 2026-08-15 01:29:27 | 0 |
|
HA-MBP-TEVpCS-ADGRG1 CTF-FLAG Resource Report Resource Website |
RRID:Addgene_217699 | ADGRG1 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-382 | 2026-08-15 01:29:26 | 0 |
|
HA-MBP-TEVpCS-ADGRG2 CTFdeltaTA-FLAG Resource Report Resource Website |
RRID:Addgene_217733 | ADGRG2 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-612 | 2026-08-15 01:29:26 | 0 |
|
HA-MBP-TEVpCS-ADGRF4 CTFdeltaTA-FLAG Resource Report Resource Website |
RRID:Addgene_217730 | ADGRF4 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-390 | 2026-08-15 01:29:26 | 0 |
|
HA-MBP-TEVpCS-ADGRF4 CTF-FLAG Resource Report Resource Website |
RRID:Addgene_217697 | ADGRF4 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-384 | 2026-08-15 01:29:27 | 0 |
|
HA-MBP-TEVpCS-ADGRF5 CTFdeltaTA-FLAG Resource Report Resource Website |
RRID:Addgene_217731 | ADGRF5 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-996 | 2026-08-15 01:29:26 | 0 |
|
HA-MBP-TEVpCS-ADGRL3 CTFdeltaTA-FLAG Resource Report Resource Website |
RRID:Addgene_217741 | ADGRL3 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-847 | 2026-08-15 01:29:27 | 0 |
|
HA-MBP-TEVpCS-ADGRL4 CTFdeltaTA-FLAG Resource Report Resource Website |
RRID:Addgene_217742 | ADGRL4 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-412 | 2026-08-15 01:29:27 | 0 |
|
pFUSE-rabbitFc1-IL2ss-VHH(B12)-His-Myc Resource Report Resource Website |
RRID:Addgene_209837 | IL2-ss | Homo sapiens | Bleocin (Zeocin) | The VHH section (termed B12) was designed through phage display by the company Hybrigenics Services (Évry-Courcouronnes, France). The nanobody was seen to be specific towards FGFR3 (mouse) and not FGFR1 or FGFR2. | Backbone Marker:Invivogen; Backbone Size:3380; Vector Backbone:pFUSE; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:28:16 | 0 | ||
|
pFUSE-rabbitFc1-IL2ss-VHH(G08)-His-Myc Resource Report Resource Website |
RRID:Addgene_209857 | IL2-ss | Homo sapiens | Bleocin (Zeocin) | The VHH (termed G08) was designed by Hybrigenics Services (Évry-Courcouronnes, France) by phage display. The VHH insert was then placed into this plasmid. In testing, this nanobody was specific for FGFR3, not FGFR2 and FGFR1. | Backbone Marker:Invivogen; Backbone Size:3380; Vector Backbone:pFUSE; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:28:16 | 0 | ||
|
pNK7181 Resource Report Resource Website |
RRID:Addgene_219766 | HmS | Hydrangea macrophylla | Bleocin (Zeocin) | PMID:38457503 | Backbone Size:3382; Vector Backbone:MoClo adapted pGAPZ-vector; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:30:05 | 0 | ||
|
pKM512 Resource Report Resource Website |
RRID:Addgene_140192 | zeocin resistance gene | Bleocin (Zeocin) | PMID:30538179 | This plasmid can be used to removed ORBIT integrated plasmids leaving behind an Bxb1 attP site. After deletion of a target gene using ORBIT, the integrated plasmid (e.g., pKM464 - hygR) is excised by expressing phage Bxb1 Integrase and gp47 (directionality factor) from pKM512. A strain containing an ORBIT-generated deletion is transformed with pKM512 selecting for zeocin resistance. (This step cures the cell of pKM461 (kanR) used to make the deletion.) Select a zeoR colony containing pKM512 and grow to saturation in 7H10-zeocin. Dilute the culture 100-fold and regrow the strain in 7H10 without zeocin, but include 500 ng/ml anhydrotetracycline, (which induces expression of Integrase and gp47). Grow to saturation again, plate for single colonies, stab colonies on 7H10 plates containing 10% sucrose (Smeg) or 3% sucrose (Mtb) looking for hygromycin-sensitive colonies. Colonies should also be sensitive to kanamycin and zeocin. Once performed, the strain cannot be used for deletion of a second gene using ORBIT, as an attP site is now present at the site of the initial deletion. | Backbone Marker:K. Murphy; Backbone Size:816; Vector Backbone:pKM461; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin) | Kanamycin resistance gene in pKM461 replaced with zeocin resistance gene by recombineering | 2026-08-15 01:28:30 | 0 | |
|
pORF1-2 Resource Report Resource Website |
RRID:Addgene_206024 | ORF1-2 derived from mouse LINE1 | Mus musculus | Bleocin (Zeocin) | PMID:33938150 | Backbone Marker:Invitrogen; Vector Backbone:pZeoSV2(+); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:29:18 | 0 | ||
|
hPLD3-sgRNA-Cas9_mcherry Resource Report Resource Website |
RRID:Addgene_199342 | hSpCas9 | Bleocin (Zeocin) | Backbone Marker:adapted from addgene #75161; Backbone Size:6800; Vector Backbone:lentiCRISPRv2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:29:40 | 0 | ||||
|
hPLD4-sgRNA-Cas9_mcherry Resource Report Resource Website |
RRID:Addgene_199343 | hSpCas9 | Bleocin (Zeocin) | Backbone Marker:adapted from addgene #99154; Backbone Size:6800; Vector Backbone:lentiCRISPRv2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Bleocin (Zeocin) | sgRNA: accagtagtatgaagccacg | 2026-08-15 01:29:40 | 0 | |||
|
mPLD3-sgRNA-Cas9-mcherry Resource Report Resource Website |
RRID:Addgene_199700 | hSpCas9 | Bleocin (Zeocin) | Backbone Marker:adapted from addgene #99154; Backbone Size:6800; Vector Backbone:lentiCRISPRv2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:29:40 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
