Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 22 showing 421 ~ 440 out of 2,175 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_21216

    This resource has 1+ mentions.

http://www.addgene.org/21216

Species: Rattus norvegicus
Genetic Insert: GFP-N2-PKCdelta-C1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4596; Vector Backbone:N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11509231

Proper citation: RRID:Addgene_21216 Copy   


  • RRID:Addgene_21215

    This resource has 1+ mentions.

http://www.addgene.org/21215

Species: Rattus norvegicus
Genetic Insert: GFP-pcDNA3-PKCgamma-c2
Vector Backbone Description: Backbone Size:5429; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11509231

Proper citation: RRID:Addgene_21215 Copy   


  • RRID:Addgene_21220

    This resource has 1+ mentions.

http://www.addgene.org/21220

Species: Rattus norvegicus
Genetic Insert: CAMKIIalpha-T286A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:0; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10102820

Proper citation: RRID:Addgene_21220 Copy   


  • RRID:Addgene_21226

    This resource has 10+ mentions.

http://www.addgene.org/21226

Species: Rattus norvegicus
Genetic Insert: CAMKIIalpha
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4725; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9768845

Proper citation: RRID:Addgene_21226 Copy   


http://www.addgene.org/21224

Species: Rattus norvegicus
Genetic Insert: CaMKIIbeta(A303R)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:0; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10102820

Proper citation: RRID:Addgene_21224 Copy   


  • RRID:Addgene_21322

    This resource has 1+ mentions.

http://www.addgene.org/21322

Species: Rattus norvegicus
Genetic Insert: ROMK1
Vector Backbone Description: Backbone Marker:Didier Trono; Backbone Size:10000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10938328

Proper citation: RRID:Addgene_21322 Copy   


  • RRID:Addgene_21621

http://www.addgene.org/21621

Species: Rattus norvegicus
Genetic Insert: Dazl shRNA-1
Vector Backbone Description: Backbone Size:8264; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Comments: Dazl shRNA sequence is - 5'-TTTGGGCTATGGATTTGTCTCATTCAAGAGATGAGACAAATCCATAGCCCTTTT

Proper citation: RRID:Addgene_21621 Copy   


  • RRID:Addgene_21633

http://www.addgene.org/21633

Species: Rattus norvegicus
Genetic Insert: Gene33
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10749885
Comments: Plasmid was also used in Xu et al. 2005 the construct can be used in cardiomyocytes There is a V to L amino acid change at position 6. The lab feels it is conservative enough not to matter.

Proper citation: RRID:Addgene_21633 Copy   


  • RRID:Addgene_21746

    This resource has 1+ mentions.

http://www.addgene.org/21746

Species: Rattus norvegicus
Genetic Insert: mTOR (1271-2008)
Vector Backbone Description: Backbone Marker:BD Pharmingen; Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12718876

Proper citation: RRID:Addgene_21746 Copy   


  • RRID:Addgene_32899

http://www.addgene.org/32899

Species: Rattus norvegicus
Genetic Insert: Mef2a
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:3176; Vector Backbone:pSuper; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16484497
Comments: Can be used in conjunction with pcDNA3-rMEF2A (Addgene #32901) which is mutated so as to not be targeted by this shRNA.

Proper citation: RRID:Addgene_32899 Copy   


  • RRID:Addgene_32907

    This resource has 1+ mentions.

http://www.addgene.org/32907

Species: Rattus norvegicus
Genetic Insert: EGFP-rat NFM fusion
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4134; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10707083
Comments: Plasmid first described in Wang et al. (2000) "Rapid movement of axonal neurofilaments interrupted by prolonged pauses" Nature Cell Biology 2:137-141.

Proper citation: RRID:Addgene_32907 Copy   


http://www.addgene.org/33332

Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Comments: The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations.

Proper citation: RRID:Addgene_33332 Copy   


http://www.addgene.org/33331

Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase alpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092

Proper citation: RRID:Addgene_33331 Copy   


http://www.addgene.org/33321

Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21669867
Comments: The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations.

Proper citation: RRID:Addgene_33321 Copy   


http://www.addgene.org/33325

Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Comments: The truncation was made by placing a stop codon at 460, but sequence was not actually removed. The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations.

Proper citation: RRID:Addgene_33325 Copy   


http://www.addgene.org/33328

Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase alpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092

Proper citation: RRID:Addgene_33328 Copy   


http://www.addgene.org/33319

Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21669867
Comments: Please note that, according to NCBI numbering, the mutation is actually S571A.

Proper citation: RRID:Addgene_33319 Copy   


  • RRID:Addgene_34611

    This resource has 10+ mentions.

http://www.addgene.org/34611

Species: Rattus norvegicus
Genetic Insert: LAMP1
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22053050

Proper citation: RRID:Addgene_34611 Copy   


http://www.addgene.org/34631

Species: Rattus norvegicus
Genetic Insert: rat Syntaxin1a
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:4733; Vector Backbone:peGFP(N1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21076040

Proper citation: RRID:Addgene_34631 Copy   


  • RRID:Addgene_34699

http://www.addgene.org/34699

Species: Rattus norvegicus
Genetic Insert: PRMT1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4948; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8647869

Proper citation: RRID:Addgene_34699 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X